pycom17g22940
HSP70 Family

Heat shock 70 kDa

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
21352863 .. 21353135
273 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g22940.1

Sequence Viewer

Length: 273 bp
ATGACCGTCTTGATTCCGAGAAACACAACCATTCCTACCAAGAAGGAGCAGATCTTCTCTACCTACTCCGACAACCAGCCAGGAGTGTTAATTCAGGTGTATGAAGGGGAGAGGGCTAGAACCAAGGACAACAACCTCCTTGGCAAGTTTGAACTCACGGGCATTCCCCCGGCGCCAAGAGGCGTCCCTCAGATCAATGTCTGCTTTGACATTGATGCAAATGGTATCTTGAATGTGTCGGCGGAAGACAAGACTGCTGGAGTGAAGAACTAG
Functional Annotation

Protein Analysis

91

Amino Acids

9.84

Weight (kDa)

6.17

Isoelectric Point (pI)

16.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 1 - 89 3.1e-35 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 172
AciI CCGC 1 cut(s) 242
AcyI GRCGYC 2 cut(s) 173, 183
AgsI TTSAA 2 cut(s) 152, 232
AjnI CCWGG 1 cut(s) 79
AspLEI GCGC 1 cut(s) 175
AsuC2I CCSGG 1 cut(s) 170
BanI GGYRCC 1 cut(s) 172
BbsI GAAGAC 1 cut(s) 252
BciT130I CCWGG 1 cut(s) 81
BcnI CCSGG 1 cut(s) 170
BfaI CTAG 2 cut(s) 117, 271
BfoI RGCGCY 1 cut(s) 176
BglII AGATCT 1 cut(s) 51
Bme1390I CCNGG 2 cut(s) 81, 170
BmiI GGNNCC 1 cut(s) 174
BmrFI CCNGG 2 cut(s) 81, 170
BmsI GCATC 1 cut(s) 205
BpiI GAAGAC 1 cut(s) 252
BpuMI CCSGG 1 cut(s) 170
BsaHI GRCGYC 2 cut(s) 173, 183
BsaJI CCNNGG 3 cut(s) 123, 139, 168
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 3 cut(s) 123, 139, 168
BseMII CTCAG 1 cut(s) 203
BshNI GGYRCC 1 cut(s) 172
BsiSI CCGG 1 cut(s) 170
BslFI GGGAC 1 cut(s) 170
BsmFI GGGAC 1 cut(s) 170
BsmI GAATGC 1 cut(s) 162
Bsp143I GATC 2 cut(s) 51, 192
BspACI CCGC 1 cut(s) 242
BspCNI CTCAG 1 cut(s) 202
BspLI GGNNCC 1 cut(s) 174
BspT107I GGYRCC 1 cut(s) 172
BssECI CCNNGG 3 cut(s) 123, 139, 168
BssMI GATC 2 cut(s) 51, 192
BssNI GRCGYC 2 cut(s) 173, 183
BssT1I CCWWGG 2 cut(s) 123, 139
Bst2UI CCWGG 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 7
BstACI GRCGYC 2 cut(s) 173, 183
BstDEI CTNAG 1 cut(s) 189
BstH2I RGCGCY 1 cut(s) 176
BstHHI GCGC 1 cut(s) 175
BstKTI GATC 2 cut(s) 54, 195
BstMBI GATC 2 cut(s) 51, 192
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 2 cut(s) 79, 168
BstV2I GAAGAC 1 cut(s) 252
BstX2I RGATCY 1 cut(s) 51
BstYI RGATCY 1 cut(s) 51
CfoI GCGC 1 cut(s) 175
CseI GACGC 1 cut(s) 172
CviJI RGCY 2 cut(s) 79, 116
CviKI_1 RGCY 2 cut(s) 79, 116
DdeI CTNAG 1 cut(s) 189
DinI GGCGCC 1 cut(s) 174
DpnI GATC 2 cut(s) 53, 194
DpnII GATC 2 cut(s) 51, 192
EciI GGCGGA 1 cut(s) 257
Eco130I CCWWGG 2 cut(s) 123, 139
EcoRII CCWGG 1 cut(s) 79
EcoT14I CCWWGG 2 cut(s) 123, 139
EgeI GGCGCC 1 cut(s) 174
EheI GGCGCC 1 cut(s) 174
ErhI CCWWGG 2 cut(s) 123, 139
FaiI YATR 1 cut(s) 102
FaqI GGGAC 1 cut(s) 170
FspBI CTAG 2 cut(s) 117, 271
GlaI GCGC 1 cut(s) 174
HaeII RGCGCY 1 cut(s) 176
HapII CCGG 1 cut(s) 170
HgaI GACGC 1 cut(s) 172
HhaI GCGC 1 cut(s) 175
Hin1I GRCGYC 2 cut(s) 173, 183
Hin6I GCGC 1 cut(s) 173
HinP1I GCGC 1 cut(s) 173
HinfI GANTC 1 cut(s) 13
HpaII CCGG 1 cut(s) 170
Hpy188I TCNGA 3 cut(s) 18, 70, 192
Hpy188III TCNNGA 2 cut(s) 10, 229
HpyAV CCTTC 2 cut(s) 37, 98
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 218
HpyF3I CTNAG 1 cut(s) 189
Hsp92I GRCGYC 2 cut(s) 173, 183
HspAI GCGC 1 cut(s) 173
KasI GGCGCC 1 cut(s) 172
Kzo9I GATC 2 cut(s) 51, 192
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 6 cut(s) 66, 80, 89, 93, 183, 243
LweI GCATC 1 cut(s) 205
MaeI CTAG 2 cut(s) 117, 271
MalI GATC 2 cut(s) 53, 194
MboI GATC 2 cut(s) 51, 192
MboII GAAGA 2 cut(s) 46, 257
MflI RGATCY 1 cut(s) 51
MluCI AATT 1 cut(s) 90
Mly113I GGCGCC 1 cut(s) 173
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 4 cut(s) 105, 146, 173, 198
MseI TTAA 1 cut(s) 89
MspI CCGG 1 cut(s) 170
MspR9I CCNGG 2 cut(s) 81, 170
Mva1269I GAATGC 1 cut(s) 162
MvaI CCWGG 1 cut(s) 81
NarI GGCGCC 1 cut(s) 173
NciI CCSGG 1 cut(s) 170
NdeII GATC 2 cut(s) 51, 192
NlaIV GGNNCC 1 cut(s) 174
PctI GAATGC 1 cut(s) 162
PfeI GAWTC 1 cut(s) 13
PluTI GGCGCC 1 cut(s) 176
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 174
PsuI RGATCY 1 cut(s) 51
SaqAI TTAA 1 cut(s) 89
Sau3AI GATC 2 cut(s) 51, 192
ScrFI CCNGG 2 cut(s) 81, 170
SetI ASST 3 cut(s) 65, 99, 138
SfaNI GCATC 1 cut(s) 205
SfoI GGCGCC 1 cut(s) 174
Sse9I AATT 1 cut(s) 90
SsiI CCGC 1 cut(s) 242
SspDI GGCGCC 1 cut(s) 172
SspMI CTAG 2 cut(s) 117, 271
StyD4I CCNGG 2 cut(s) 79, 168
StyI CCWWGG 2 cut(s) 123, 139
TaaI ACNGT 1 cut(s) 7
TasI AATT 1 cut(s) 90
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 117
XspI CTAG 2 cut(s) 117, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.