pycom420g00720

Retroviral aspartyl protease

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
Physical Location & Seq
Forward (+)
875902 .. 876239
338 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGCAATCAAAGTCTAGTTCTTTAACTATTGAGCAACGGCATGAATTAGAGGAATTATTGGATGAGTTTGCTGCTATTTTTCAAGCACCTTTTGTGCTTCCTCCTTCAAGATCTCACGATCACAAGATCCTTCTTTTGGACGGCAGTAAGCCTCCTAGTGCCAGACCTTACAAGTATGGTCCTTTTCAGAAGACTAAAATTGAGAAGTGTGTTAACGAACTCTGGGTTGCCGGATTTATCAGACCGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.51

Weight (kDa)

7.91

Isoelectric Point (pI)

71.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019119)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 2 cut(s) 83, 108
AlwI GGATC 1 cut(s) 121
ApeKI GCWGC 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 179
AvaII GGWCC 1 cut(s) 179
BbsI GAAGAC 1 cut(s) 197
BbvI GCAGC 1 cut(s) 58
BceAI ACGGC 2 cut(s) 53, 157
BfaI CTAG 2 cut(s) 15, 156
BglII AGATCT 1 cut(s) 110
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 1 cut(s) 179
BpiI GAAGAC 1 cut(s) 197
Bsc4I CCNNNNNNNGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 136
BseXI GCAGC 1 cut(s) 58
BsiSI CCGG 1 cut(s) 231
BslI CCNNNNNNNGG 1 cut(s) 136
Bsp143I GATC 3 cut(s) 110, 118, 126
BspPI GGATC 1 cut(s) 121
BssMI GATC 3 cut(s) 110, 118, 126
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 3 cut(s) 113, 121, 129
BstMBI GATC 3 cut(s) 110, 118, 126
BstV1I GCAGC 1 cut(s) 58
BstV2I GAAGAC 1 cut(s) 197
BstX2I RGATCY 2 cut(s) 110, 126
BstYI RGATCY 2 cut(s) 110, 126
BtsCI GGATG 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 179
CviAII CATG 1 cut(s) 41
CviJI RGCY 1 cut(s) 151
CviKI_1 RGCY 1 cut(s) 151
DpnI GATC 3 cut(s) 112, 120, 128
DpnII GATC 3 cut(s) 110, 118, 126
Eco47I GGWCC 1 cut(s) 179
FaeI CATG 1 cut(s) 44
FaiI YATR 2 cut(s) 42, 177
FatI CATG 1 cut(s) 40
Fnu4HI GCNGC 1 cut(s) 72
FokI GGATG 1 cut(s) 74
Fsp4HI GCNGC 1 cut(s) 72
FspBI CTAG 2 cut(s) 15, 156
GluI GCNGC 1 cut(s) 72
HapII CCGG 1 cut(s) 231
Hin1II CATG 1 cut(s) 44
HincII GTYRAC 1 cut(s) 214
HindII GTYRAC 1 cut(s) 214
HpaI GTTAAC 1 cut(s) 214
HpaII CCGG 1 cut(s) 231
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 2 cut(s) 189, 242
Hpy188III TCNNGA 2 cut(s) 108, 116
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 2 cut(s) 114, 140
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 44
KspAI GTTAAC 1 cut(s) 214
Kzo9I GATC 3 cut(s) 110, 118, 126
LpnPI CCDG 3 cut(s) 175, 208, 244
Lsp1109I GCAGC 1 cut(s) 58
MaeI CTAG 2 cut(s) 15, 156
MalI GATC 3 cut(s) 112, 120, 128
MboI GATC 3 cut(s) 110, 118, 126
MboII GAAGA 1 cut(s) 202
MflI RGATCY 2 cut(s) 110, 126
MluCI AATT 3 cut(s) 44, 53, 198
MnlI CCTC 3 cut(s) 43, 111, 162
MseI TTAA 2 cut(s) 23, 213
MspI CCGG 1 cut(s) 231
NdeII GATC 3 cut(s) 110, 118, 126
NlaIII CATG 1 cut(s) 44
PkrI GCNGC 1 cut(s) 73
PspPI GGNCC 1 cut(s) 179
PsuI RGATCY 2 cut(s) 110, 126
SaqAI TTAA 2 cut(s) 23, 213
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 3 cut(s) 110, 118, 126
Sau96I GGNCC 1 cut(s) 179
SetI ASST 2 cut(s) 91, 169
SinI GGWCC 1 cut(s) 179
Sse9I AATT 3 cut(s) 44, 53, 198
SspMI CTAG 2 cut(s) 15, 156
TasI AATT 3 cut(s) 44, 53, 198
Tru1I TTAA 2 cut(s) 23, 213
Tru9I TTAA 2 cut(s) 23, 213
TseI GCWGC 1 cut(s) 71
TspDTI ATGAA 1 cut(s) 57
VpaK11BI GGWCC 1 cut(s) 179
XspI CTAG 2 cut(s) 15, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.