RchiOBHm_Chr5g0057291

Macrophage erythroblast

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
61201864 .. 61203427
1564 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 393 bp
ATGTCTCAGGATCTTGCTCATAGCGATGTATTTCAAGAAACCAGAAAGGTTATTGAAGCTTTCCAGAATAAGGAGGTAGGCCCTGCCCTATCCTGGTGTGCCGAGAACAAGTCAAGGTTAAAGAAATCCAAAGTATGCATTCTCTTTTTCTTTTGTGTACGTTGGTGGGGAGACCTTGCTATAATTGGGGTGGTTTTATTTGAACCAAAACAATGGGATTACCCGGTTGACCAATTCAAACAAGAATTCTGCAAGTTGTATGGCATAACGTTTGAGCCTCTGTTGAATATTTATCTGCAAGCAGGACTCTCTGCTCTGAAAACCCGGTATCTGTTTACTGATATTTATCTGATTTCTATATTGTTGTCCTCATATACATTTAATCTTCTCTAG

Protein Analysis

130

Amino Acids

15.2

Weight (kDa)

7.62

Isoelectric Point (pI)

43.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTLH PF10607 10 - 51 3e-06 CTLH/CRA C-terminal to LisH motif domain
CTLH PF10607 66 - 109 9.5e-10 CTLH/CRA C-terminal to LisH motif domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018579)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 269
AclWI GGATC 1 cut(s) 18
AcsI RAATTY 1 cut(s) 245
AfaI GTAC 1 cut(s) 159
AfiI CCNNNNNNNGG 2 cut(s) 70, 93
AgsI TTSAA 5 cut(s) 35, 56, 203, 238, 286
AjnI CCWGG 1 cut(s) 92
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw26I GTCTC 2 cut(s) 9, 165
AlwI GGATC 1 cut(s) 18
AoxI GGCC 1 cut(s) 79
ApoI RAATTY 1 cut(s) 245
AspS9I GGNCC 1 cut(s) 80
AsuC2I CCSGG 2 cut(s) 224, 325
BciT130I CCWGG 1 cut(s) 94
BcnI CCSGG 2 cut(s) 224, 325
BcoDI GTCTC 2 cut(s) 9, 165
BfaI CTAG 1 cut(s) 391
Bme1390I CCNGG 3 cut(s) 94, 224, 325
BmgT120I GGNCC 1 cut(s) 80
BmrFI CCNGG 3 cut(s) 94, 224, 325
BpuMI CCSGG 2 cut(s) 224, 325
BsaBI GATNNNNATC 1 cut(s) 345
BsaI GGTCTC 1 cut(s) 165
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 93
Bse8I GATNNNNATC 1 cut(s) 345
BseBI CCWGG 1 cut(s) 94
BseJI GATNNNNATC 1 cut(s) 345
BseLI CCNNNNNNNGG 2 cut(s) 70, 93
BseMII CTCAG 1 cut(s) 20
BshFI GGCC 1 cut(s) 81
BsiSI CCGG 2 cut(s) 224, 325
BslI CCNNNNNNNGG 2 cut(s) 70, 93
BsmAI GTCTC 2 cut(s) 9, 165
BsmI GAATGC 1 cut(s) 138
BsnI GGCC 1 cut(s) 81
Bso31I GGTCTC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 10
BspANI GGCC 1 cut(s) 81
BspCNI CTCAG 1 cut(s) 19
BspPI GGATC 1 cut(s) 18
BspTNI GGTCTC 1 cut(s) 165
BssMI GATC 1 cut(s) 10
Bst2UI CCWGG 1 cut(s) 94
BstC8I GCNNGC 1 cut(s) 300
BstDEI CTNAG 1 cut(s) 6
BstKTI GATC 1 cut(s) 13
BstMAI GTCTC 2 cut(s) 9, 165
BstMBI GATC 1 cut(s) 10
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 3 cut(s) 92, 222, 323
BstX2I RGATCY 1 cut(s) 10
BstXI CCANNNNNNTGG 1 cut(s) 213
BstYI RGATCY 1 cut(s) 10
BsuRI GGCC 1 cut(s) 81
BtgZI GCGATG 1 cut(s) 39
Cac8I GCNNGC 1 cut(s) 300
Cfr13I GGNCC 1 cut(s) 80
Csp6I GTAC 1 cut(s) 158
CviJI RGCY 3 cut(s) 59, 81, 277
CviKI_1 RGCY 3 cut(s) 59, 81, 277
CviQI GTAC 1 cut(s) 158
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 12
DpnII GATC 1 cut(s) 10
Eco31I GGTCTC 1 cut(s) 165
EcoO109I RGGNCCY 1 cut(s) 80
EcoRI GAATTC 1 cut(s) 245
EcoRII CCWGG 1 cut(s) 92
EcoT22I ATGCAT 1 cut(s) 140
FaiI YATR 8 cut(s) 21, 136, 182, 261, 266, 359, 373, 375
FspBI CTAG 1 cut(s) 391
HaeIII GGCC 1 cut(s) 81
HapII CCGG 2 cut(s) 224, 325
HincII GTYRAC 1 cut(s) 229
HindII GTYRAC 1 cut(s) 229
HindIII AAGCTT 1 cut(s) 57
HinfI GANTC 1 cut(s) 306
HpaII CCGG 2 cut(s) 224, 325
Hpy166II GTNNAC 3 cut(s) 158, 229, 336
Hpy188I TCNGA 2 cut(s) 318, 351
Hpy188III TCNNGA 3 cut(s) 8, 35, 64
Hpy8I GTNNAC 3 cut(s) 158, 229, 336
HpyCH4IV ACGT 2 cut(s) 160, 269
HpyCH4V TGCA 3 cut(s) 138, 252, 298
HpyF3I CTNAG 1 cut(s) 6
HpySE526I ACGT 2 cut(s) 160, 269
Kzo9I GATC 1 cut(s) 10
LpnPI CCDG 8 cut(s) 55, 77, 79, 96, 106, 237, 288, 338
MaeI CTAG 1 cut(s) 391
MaeII ACGT 2 cut(s) 160, 269
MalI GATC 1 cut(s) 12
MboI GATC 1 cut(s) 10
MboII GAAGA 1 cut(s) 377
MflI RGATCY 1 cut(s) 10
MluCI AATT 3 cut(s) 183, 233, 245
MlyI GAGTC 1 cut(s) 300
MnlI CCTC 3 cut(s) 67, 288, 379
Mph1103I ATGCAT 1 cut(s) 140
MseI TTAA 2 cut(s) 119, 381
MslI CAYNNNNRTG 1 cut(s) 24
MspI CCGG 2 cut(s) 224, 325
MspR9I CCNGG 3 cut(s) 94, 224, 325
Mva1269I GAATGC 1 cut(s) 138
MvaI CCWGG 1 cut(s) 94
NciI CCSGG 2 cut(s) 224, 325
NdeII GATC 1 cut(s) 10
NmeAIII GCCGAG 1 cut(s) 127
NsiI ATGCAT 1 cut(s) 140
PctI GAATGC 1 cut(s) 138
PleI GAGTC 1 cut(s) 300
PpsI GAGTC 1 cut(s) 300
Psp1406I AACGTT 1 cut(s) 269
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspPI GGNCC 1 cut(s) 80
PsuI RGATCY 1 cut(s) 10
RsaI GTAC 1 cut(s) 159
RsaNI GTAC 1 cut(s) 158
RseI CAYNNNNRTG 1 cut(s) 24
SaqAI TTAA 2 cut(s) 119, 381
Sau3AI GATC 1 cut(s) 10
Sau96I GGNCC 1 cut(s) 80
SchI GAGTC 1 cut(s) 300
ScrFI CCNGG 3 cut(s) 94, 224, 325
SetI ASST 7 cut(s) 51, 61, 78, 119, 163, 177, 272
SmiMI CAYNNNNRTG 1 cut(s) 24
Sse9I AATT 3 cut(s) 183, 233, 245
SspI AATATT 1 cut(s) 289
SspMI CTAG 1 cut(s) 391
StyD4I CCNGG 3 cut(s) 92, 222, 323
TaiI ACGT 2 cut(s) 163, 272
TasI AATT 3 cut(s) 183, 233, 245
Tru1I TTAA 2 cut(s) 119, 381
Tru9I TTAA 2 cut(s) 119, 381
XapI RAATTY 1 cut(s) 245
XspI CTAG 1 cut(s) 391
Zsp2I ATGCAT 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.