RchiOBHm_Chr5g0076581

WEB family protein At5g55860-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
82216868 .. 82219425
2558 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGGTTGCAAAAGACCACCAGAGTGCTACAAATTCTCCTAGTCCTAAAGTGGAGGTGGGAGAGATTGACACCAGGGCACCTTTCCAATCTGTTAAAGATGCTGTGTCACTATTTGGTGAGGGGGCCTTCTCTGGCTCTGGGGAGAAACCTGCCATTAGGAAGATAAAACCCTACGAGTGCTAG

Protein Analysis

60

Amino Acids

6.39

Weight (kDa)

6.54

Isoelectric Point (pI)

42.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 157
AccB1I GGYRCC 1 cut(s) 76
AcsI RAATTY 1 cut(s) 31
AjnI CCWGG 1 cut(s) 71
AleI CACNNNNGTG 1 cut(s) 21
AoxI GGCC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 128
BaeGI GKGCMC 1 cut(s) 79
BanI GGYRCC 1 cut(s) 76
BciT130I CCWGG 1 cut(s) 73
BfaI CTAG 2 cut(s) 39, 181
BfuAI ACCTGC 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 123
BmiI GGNNCC 2 cut(s) 78, 124
BmrFI CCNGG 1 cut(s) 73
BmsI GCATC 1 cut(s) 88
BsaJI CCNNGG 1 cut(s) 72
BsaXI ACNNNNNCTCC 2 cut(s) 19, 49
BseBI CCWGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 72
BseSI GKGCMC 1 cut(s) 79
BshFI GGCC 1 cut(s) 125
BshNI GGYRCC 1 cut(s) 76
BsnI GGCC 1 cut(s) 125
Bsp1286I GDGCHC 1 cut(s) 79
BspANI GGCC 1 cut(s) 125
BspLI GGNNCC 2 cut(s) 78, 124
BspMI ACCTGC 1 cut(s) 157
BspT107I GGYRCC 1 cut(s) 76
BssECI CCNNGG 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 73
BstNI CCWGG 1 cut(s) 73
BstSCI CCNGG 1 cut(s) 71
BstSLI GKGCMC 1 cut(s) 79
BsuRI GGCC 1 cut(s) 125
BveI ACCTGC 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 123
CviJI RGCY 2 cut(s) 125, 135
CviKI_1 RGCY 2 cut(s) 125, 135
EcoO109I RGGNCCY 1 cut(s) 123
EcoRII CCWGG 1 cut(s) 71
FspBI CTAG 2 cut(s) 39, 181
HaeIII GGCC 1 cut(s) 125
HphI GGTGA 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 136
HpyCH4V TGCA 1 cut(s) 8
LpnPI CCDG 6 cut(s) 32, 58, 85, 117, 123, 162
LweI GCATC 1 cut(s) 88
MaeI CTAG 2 cut(s) 39, 181
MaeIII GTNAC 1 cut(s) 105
MboII GAAGA 1 cut(s) 172
MhlI GDGCHC 1 cut(s) 79
MluCI AATT 1 cut(s) 31
MnlI CCTC 2 cut(s) 46, 112
MseI TTAA 1 cut(s) 93
MslI CAYNNNNRTG 1 cut(s) 21
MspR9I CCNGG 1 cut(s) 73
MvaI CCWGG 1 cut(s) 73
NlaIV GGNNCC 2 cut(s) 78, 124
NmuCI GTSAC 1 cut(s) 105
OliI CACNNNNGTG 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 71
PspGI CCWGG 1 cut(s) 71
PspN4I GGNNCC 2 cut(s) 78, 124
PspPI GGNCC 1 cut(s) 123
RseI CAYNNNNRTG 1 cut(s) 21
SaqAI TTAA 1 cut(s) 93
Sau96I GGNCC 1 cut(s) 123
ScrFI CCNGG 1 cut(s) 73
SduI GDGCHC 1 cut(s) 79
SetI ASST 3 cut(s) 57, 82, 151
SfaNI GCATC 1 cut(s) 88
SgeI CNNG 7 cut(s) 31, 51, 84, 85, 144, 150, 161
SmiMI CAYNNNNRTG 1 cut(s) 21
Sse9I AATT 1 cut(s) 31
SspMI CTAG 2 cut(s) 39, 181
StyD4I CCNGG 1 cut(s) 71
TasI AATT 1 cut(s) 31
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TseFI GTSAC 1 cut(s) 105
Tsp45I GTSAC 1 cut(s) 105
XapI RAATTY 1 cut(s) 31
XspI CTAG 2 cut(s) 39, 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.