RchiOBHm_Chr4g0424991

receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
50654532 .. 50656435
1904 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 168 bp
ATGCTTAAAGGTTGTATCTTTGTGCAGGTTTGGCTTTGGAGTTTTAGAGAGAGAGTAGTGAGTGACCCATTTGATGGTTTGTCGAATTGGAATGATAAAGATGGAGATATTGACCCTTGCTCTTGGTTTGGGGTTGAATGCGTAGATGGAAAAATTGTGGTCTTGTAA

Protein Analysis

55

Amino Acids

6.32

Weight (kDa)

4.27

Isoelectric Point (pI)

14.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRRNT_2 PF08263 14 - 47 6.4e-07 Leucine rich repeat N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019315)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 16
AccB7I CCANNNNNTGG 1 cut(s) 74
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 137
BccI CCATC 3 cut(s) 68, 95, 140
BfuAI ACCTGC 1 cut(s) 16
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 74
BsgI GTGCAG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 143
BspMI ACCTGC 1 cut(s) 16
BstMWI GCNNNNNNNGC 1 cut(s) 31
BveI ACCTGC 1 cut(s) 16
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
HpyCH4V TGCA 1 cut(s) 25
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 11
MaeIII GTNAC 1 cut(s) 62
MluCI AATT 2 cut(s) 85, 153
MseI TTAA 1 cut(s) 6
Mva1269I GAATGC 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 31
NmuCI GTSAC 1 cut(s) 62
PctI GAATGC 1 cut(s) 143
PflMI CCANNNNNTGG 1 cut(s) 74
SaqAI TTAA 1 cut(s) 6
SetI ASST 2 cut(s) 13, 30
SgeI CNNG 3 cut(s) 38, 129, 135
Sse9I AATT 2 cut(s) 85, 153
TaqI TCGA 1 cut(s) 83
TasI AATT 2 cut(s) 85, 153
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
Van91I CCANNNNNTGG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.