RchiOBHm_Chr7g0197371

receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
15328624 .. 15329566
943 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17657

Sequence Viewer

Length: 153 bp
ATGCTTAAAGTAGTGAGTGACCCATTTGGTGGTTTTTCGAATTGGAATGATGAAGACGGAGATATTGACCCTTACTCTTGGTTTGGGGTTGAATGGTTAGATGGAAAAAATTGTGGTCTTGCAAGTACTCTCTTTGTTTCTTCTTTCATTTAA

Protein Analysis

50

Amino Acids

5.56

Weight (kDa)

4.05

Isoelectric Point (pI)

18.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019315)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 29
AfaI GTAC 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 1 cut(s) 92
AsuII TTCGAA 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 60
BccI CCATC 1 cut(s) 95
BmcAI AGTACT 1 cut(s) 127
BpiI GAAGAC 1 cut(s) 60
Bpu14I TTCGAA 1 cut(s) 38
Bsc4I CCNNNNNNNGG 1 cut(s) 29
BseLI CCNNNNNNNGG 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 29
Bsp119I TTCGAA 1 cut(s) 38
BspT104I TTCGAA 1 cut(s) 38
BstBI TTCGAA 1 cut(s) 38
BstV2I GAAGAC 1 cut(s) 60
Csp6I GTAC 1 cut(s) 126
CviQI GTAC 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 17
MboII GAAGA 2 cut(s) 65, 132
MluCI AATT 2 cut(s) 40, 109
MseI TTAA 2 cut(s) 6, 151
NmuCI GTSAC 1 cut(s) 17
NspV TTCGAA 1 cut(s) 38
PflMI CCANNNNNTGG 1 cut(s) 29
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
SaqAI TTAA 2 cut(s) 6, 151
ScaI AGTACT 1 cut(s) 127
SfuI TTCGAA 1 cut(s) 38
SgeI CNNG 3 cut(s) 90, 131, 135
Sse9I AATT 2 cut(s) 40, 109
TaqI TCGA 1 cut(s) 38
TasI AATT 2 cut(s) 40, 109
TatI WGTACW 1 cut(s) 125
Tru1I TTAA 2 cut(s) 6, 151
Tru9I TTAA 2 cut(s) 6, 151
TseFI GTSAC 1 cut(s) 17
Tsp45I GTSAC 1 cut(s) 17
TspDTI ATGAA 2 cut(s) 66, 136
TspGWI ACGGA 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 29
ZrmI AGTACT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.