Rroxscaffold_5G00341270

receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
9814704 .. 9818339
3636 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00341270.1

Sequence Viewer

Length: 360 bp
ATGCTTAAAGGTTGTATCTTATGCAGGTTTAGCTTTGGAGTTTTAGAGAGAGTAGTGACTGACCCATTTGGTGGTTTGTCGAATTGGAATGATGAAGATGGAGATATTGACCCTTGCTCTAGGTTTGGGGTTGAATGCTTAGATGGAAAAATTGTGGTCTTAGATGCCAGTTTCAAGATTAAGTCTGAAATAAATTCGGTGATTGAGGTTGTTGAGGAAATCATTATATTTCTGAATAAGAAAAAAGACCAACTGGAAGCCCAAGCAAGGGAGAGGAGAGGCAACAGTCAATATACCAAAGCAGACATAGATATGATGCGAAATGAATGGGCAAAGTATGTCGTGAAGGCGTATGTGTAG

Protein Analysis

119

Amino Acids

13.57

Weight (kDa)

5.04

Isoelectric Point (pI)

28.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019315)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 15
AccB7I CCANNNNNTGG 1 cut(s) 71
AcsI RAATTY 1 cut(s) 193
AfiI CCNNNNNNNGG 3 cut(s) 71, 267, 268
AgsI TTSAA 2 cut(s) 134, 175
AluBI AGCT 1 cut(s) 33
AluI AGCT 1 cut(s) 33
ApoI RAATTY 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 211
BccI CCATC 2 cut(s) 92, 137
BfaI CTAG 1 cut(s) 120
BfuAI ACCTGC 1 cut(s) 15
BmsI GCATC 2 cut(s) 154, 306
Bsc4I CCNNNNNNNGG 3 cut(s) 71, 267, 268
Bse1I ACTGG 2 cut(s) 168, 258
BseLI CCNNNNNNNGG 3 cut(s) 71, 267, 268
BseNI ACTGG 2 cut(s) 168, 258
BseRI GAGGAG 1 cut(s) 289
BslI CCNNNNNNNGG 3 cut(s) 71, 267, 268
BsmI GAATGC 1 cut(s) 140
BspMI ACCTGC 1 cut(s) 15
BsrI ACTGG 2 cut(s) 168, 258
Bst4CI ACNGT 1 cut(s) 287
BstDEI CTNAG 2 cut(s) 139, 160
BstMWI GCNNNNNNNGC 1 cut(s) 30
BveI ACCTGC 1 cut(s) 15
CviJI RGCY 2 cut(s) 33, 260
CviKI_1 RGCY 2 cut(s) 33, 260
DdeI CTNAG 2 cut(s) 139, 160
FaiI YATR 7 cut(s) 22, 227, 294, 308, 314, 339, 354
FspBI CTAG 1 cut(s) 120
HphI GGTGA 1 cut(s) 211
Hpy188I TCNGA 2 cut(s) 187, 234
Hpy188III TCNNGA 2 cut(s) 175, 343
HpyAV CCTTC 1 cut(s) 340
HpyCH4III ACNGT 1 cut(s) 287
HpyCH4V TGCA 1 cut(s) 24
HpyF10VI GCNNNNNNNGC 1 cut(s) 30
HpyF3I CTNAG 2 cut(s) 139, 160
LpnPI CCDG 3 cut(s) 10, 181, 239
LweI GCATC 2 cut(s) 154, 306
MaeI CTAG 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 55
MboII GAAGA 1 cut(s) 107
MluCI AATT 3 cut(s) 82, 150, 193
MnlI CCTC 4 cut(s) 199, 208, 267, 272
MseI TTAA 2 cut(s) 6, 180
MslI CAYNNNNRTG 1 cut(s) 311
Mva1269I GAATGC 1 cut(s) 140
MwoI GCNNNNNNNGC 1 cut(s) 30
NmuCI GTSAC 1 cut(s) 55
PctI GAATGC 1 cut(s) 140
PflMI CCANNNNNTGG 1 cut(s) 71
RseI CAYNNNNRTG 1 cut(s) 311
SaqAI TTAA 2 cut(s) 6, 180
SetI ASST 5 cut(s) 13, 29, 35, 125, 210
SfaNI GCATC 2 cut(s) 154, 306
SgeI CNNG 9 cut(s) 37, 126, 132, 180, 187, 266, 275, 279, 355
SmiMI CAYNNNNRTG 1 cut(s) 311
Sse9I AATT 3 cut(s) 82, 150, 193
SspMI CTAG 1 cut(s) 120
TaaI ACNGT 1 cut(s) 287
TaqI TCGA 1 cut(s) 80
TasI AATT 3 cut(s) 82, 150, 193
Tru1I TTAA 2 cut(s) 6, 180
Tru9I TTAA 2 cut(s) 6, 180
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 2 cut(s) 108, 339
Van91I CCANNNNNTGG 1 cut(s) 71
XapI RAATTY 1 cut(s) 193
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.