Rroxscaffold_2G00117410

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
45249975 .. 45250311
337 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00117410.1

Sequence Viewer

Length: 150 bp
ATGCGTTACATGAGAGACATCATTGAGGATAAAGACTTGACATTGTTTCCAAGAAAGGTACAAAGGAGAGGCAACAGTCAATATACCCAAGCAGACATAGATATGATGCGAAATGAATGGGCAAAGTATGTTGTGAAGGCGTATGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

6.04

Weight (kDa)

9.52

Isoelectric Point (pI)

25.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019315)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 60
Alw26I GTCTC 1 cut(s) 9
BcoDI GTCTC 1 cut(s) 9
BmsI GCATC 1 cut(s) 96
BsmAI GTCTC 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 77
BstMAI GTCTC 1 cut(s) 9
Csp6I GTAC 1 cut(s) 59
CviAII CATG 1 cut(s) 10
CviQI GTAC 1 cut(s) 59
FaeI CATG 1 cut(s) 13
FaiI YATR 6 cut(s) 11, 84, 98, 104, 129, 144
FatI CATG 1 cut(s) 9
Hin1II CATG 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 130
HpyCH4III ACNGT 1 cut(s) 77
Hsp92II CATG 1 cut(s) 13
LweI GCATC 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 5
MnlI CCTC 2 cut(s) 19, 62
MslI CAYNNNNRTG 1 cut(s) 101
NlaIII CATG 1 cut(s) 13
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
RseI CAYNNNNRTG 1 cut(s) 101
SetI ASST 1 cut(s) 60
SfaNI GCATC 1 cut(s) 96
SgeI CNNG 4 cut(s) 22, 49, 63, 101
SmiMI CAYNNNNRTG 1 cut(s) 101
TaaI ACNGT 1 cut(s) 77
TspDTI ATGAA 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.