Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0019315

Physical Location & Seq

Genomic Coordinates Forward (+)

50654532 .. 50656435

Gene Structure 1904 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ39423

Sequence Viewer

CDS Protein Promoter (2k)

Length: 168 bp

ATGCTTAAAGGTTGTATCTTTGTGCAGGTTTGGCTTTGGAGTTTTAGAGAGAGAGTAGTGAGTGACCCATTTGATGGTTTGTCGAATTGGAATGATAAAGATGGAGATATTGACCCTTGCTCTTGGTTTGGGGTTGAATGCGTAGATGGAAAAATTGTGGTCTTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

LRRNT_2 LRR_8 Pkinase_Tyr

Protein Analysis

55

Amino Acids

6.32

Weight (kDa)

4.27

Isoelectric Point (pI)

14.35

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LRRNT_2	PF08263	14 - 47	6.4e-07	Leucine rich repeat N-terminal domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019315)

Species	Orthologous Gene IDs
pyrus_communis	pycom03g04990
rosa_chinensis	RchiOBHm_Chr4g0424991 RchiOBHm_Chr7g0197371
rosa_roxburghii	Rroxscaffold_1G00042530 Rroxscaffold_2G00117410 Rroxscaffold_5G00341270
rosa_samantha	Rh1BG333000 Rh1DG364200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	16
AccB7I	CCANNNNNTGG	1 cut(s)	74
AfiI	CCNNNNNNNGG	1 cut(s)	74
AgsI	TTSAA	1 cut(s)	137
BccI	CCATC	3 cut(s)	68, 95, 140
BfuAI	ACCTGC	1 cut(s)	16
Bsc4I	CCNNNNNNNGG	1 cut(s)	74
BseLI	CCNNNNNNNGG	1 cut(s)	74
BsgI	GTGCAG	1 cut(s)	44
BslI	CCNNNNNNNGG	1 cut(s)	74
BsmI	GAATGC	1 cut(s)	143
BspMI	ACCTGC	1 cut(s)	16
BstMWI	GCNNNNNNNGC	1 cut(s)	31
BveI	ACCTGC	1 cut(s)	16
CviJI	RGCY	1 cut(s)	34
CviKI_1	RGCY	1 cut(s)	34
HpyCH4V	TGCA	1 cut(s)	25
HpyF10VI	GCNNNNNNNGC	1 cut(s)	31
LpnPI	CCDG	1 cut(s)	11
MaeIII	GTNAC	1 cut(s)	62
MluCI	AATT	2 cut(s)	85, 153
MseI	TTAA	1 cut(s)	6
Mva1269I	GAATGC	1 cut(s)	143
MwoI	GCNNNNNNNGC	1 cut(s)	31
NmuCI	GTSAC	1 cut(s)	62
PctI	GAATGC	1 cut(s)	143
PflMI	CCANNNNNTGG	1 cut(s)	74
SaqAI	TTAA	1 cut(s)	6
SetI	ASST	2 cut(s)	13, 30
SgeI	CNNG	3 cut(s)	38, 129, 135
Sse9I	AATT	2 cut(s)	85, 153
TaqI	TCGA	1 cut(s)	83
TasI	AATT	2 cut(s)	85, 153
Tru1I	TTAA	1 cut(s)	6
Tru9I	TTAA	1 cut(s)	6
TseFI	GTSAC	1 cut(s)	62
Tsp45I	GTSAC	1 cut(s)	62
Van91I	CCANNNNNTGG	1 cut(s)	74

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.