RchiOBHm_Chr4g0430061

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
54710384 .. 54710889
506 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 243 bp
ATGGGAAGAAACTTTGAGCTTATTCCATTTGGTGGTGGGAGGAGAAGATGTCCGGGGTTGCCTTTGGCATTGATATTAGGGTTGCTCATTAACTGCTTTGAATGGAAGCTCGAAGATGGTGTTGTACCAAAGACTATGAACATGGAGGAGAAGTTTGGCATCAACTTAAGAATGGCTCAGCCTCCTAGAGCTGTGCCCATGCCAACAAGTCATAATCCCTTTATACAATTCATATTAATTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.05

Weight (kDa)

9.38

Isoelectric Point (pI)

61.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 4 - 53 1.6e-06 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018896)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 32
AfaI GTAC 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 32
AflII CTTAAG 1 cut(s) 166
AgsI TTSAA 1 cut(s) 101
AluBI AGCT 3 cut(s) 19, 109, 191
AluI AGCT 3 cut(s) 19, 109, 191
AseI ATTAAT 1 cut(s) 236
AsuC2I CCSGG 1 cut(s) 54
BaeGI GKGCMC 1 cut(s) 198
BccI CCATC 1 cut(s) 110
BcnI CCSGG 1 cut(s) 54
BfaI CTAG 1 cut(s) 186
BfrI CTTAAG 1 cut(s) 166
BlpI GCTNAGC 1 cut(s) 177
Bme1390I CCNGG 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 168
Bpu1102I GCTNAGC 1 cut(s) 177
BpuMI CCSGG 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 53
BsaXI ACNNNNNCTCC 4 cut(s) 34, 64, 137, 167
Bsc4I CCNNNNNNNGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMII CTCAG 1 cut(s) 191
BseRI GAGGAG 2 cut(s) 55, 161
BseSI GKGCMC 1 cut(s) 198
BsiSI CCGG 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 32
Bsp1286I GDGCHC 1 cut(s) 198
Bsp1720I GCTNAGC 1 cut(s) 177
BspCNI CTCAG 1 cut(s) 190
BspTI CTTAAG 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 53
BstAFI CTTAAG 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 177
BstSCI CCNGG 1 cut(s) 52
BstSLI GKGCMC 1 cut(s) 198
Csp6I GTAC 1 cut(s) 125
CviAII CATG 2 cut(s) 142, 199
CviJI RGCY 5 cut(s) 19, 109, 176, 181, 191
CviKI_1 RGCY 5 cut(s) 19, 109, 176, 181, 191
CviQI GTAC 1 cut(s) 125
DdeI CTNAG 1 cut(s) 177
FaeI CATG 2 cut(s) 145, 202
FaiI YATR 6 cut(s) 137, 143, 200, 213, 224, 233
FatI CATG 2 cut(s) 141, 198
FspBI CTAG 1 cut(s) 186
HapII CCGG 1 cut(s) 53
Hin1II CATG 2 cut(s) 145, 202
HpaII CCGG 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 177
Hsp92II CATG 2 cut(s) 145, 202
LpnPI CCDG 1 cut(s) 66
LweI GCATC 1 cut(s) 168
MaeI CTAG 1 cut(s) 186
MboII GAAGA 3 cut(s) 18, 57, 125
MhlI GDGCHC 1 cut(s) 198
MluCI AATT 2 cut(s) 227, 237
MnlI CCTC 3 cut(s) 33, 139, 192
MseI TTAA 4 cut(s) 90, 167, 236, 241
MspCI CTTAAG 1 cut(s) 166
MspI CCGG 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 54
NciI CCSGG 1 cut(s) 54
NlaIII CATG 2 cut(s) 145, 202
PflMI CCANNNNNTGG 1 cut(s) 32
PshBI ATTAAT 1 cut(s) 236
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
SaqAI TTAA 4 cut(s) 90, 167, 236, 241
ScrFI CCNGG 1 cut(s) 54
SduI GDGCHC 1 cut(s) 198
SetI ASST 3 cut(s) 21, 111, 193
SfaNI GCATC 1 cut(s) 168
SgeI CNNG 7 cut(s) 65, 66, 122, 154, 198, 211, 219
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
Sse9I AATT 2 cut(s) 227, 237
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 1 cut(s) 52
TaqI TCGA 1 cut(s) 111
TasI AATT 2 cut(s) 227, 237
Tru1I TTAA 4 cut(s) 90, 167, 236, 241
Tru9I TTAA 4 cut(s) 90, 167, 236, 241
TspDTI ATGAA 2 cut(s) 152, 220
Van91I CCANNNNNTGG 1 cut(s) 32
Vha464I CTTAAG 1 cut(s) 166
VspI ATTAAT 1 cut(s) 236
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.