RchiOBHm_Chr3g0484811

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
31295901 .. 31296875
975 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGGCAAGATATATCTAGTTATCTACATATATAAGATTAGCTGCATCAGAGCAAAAAAACTGAGCTGCAACCACAAGGAAAATCTGGAATTACCATTGTTAGACTTGGCTGCTGTTGTAAAAACCTGTAACTTCTCAAACGACAATAAACTAGGAGAAGGTGACTCCAGATCTGTCTTTAAGGGTATATTGAAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

66

Amino Acids

7.45

Weight (kDa)

9.1

Isoelectric Point (pI)

28.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 193
AluBI AGCT 2 cut(s) 42, 66
AluI AGCT 2 cut(s) 42, 66
ApeKI GCWGC 3 cut(s) 42, 66, 110
AsuHPI GGTGA 1 cut(s) 173
BbvI GCAGC 3 cut(s) 29, 53, 97
BfaI CTAG 2 cut(s) 17, 152
BglII AGATCT 1 cut(s) 170
BisI GCNGC 3 cut(s) 43, 67, 111
BlsI GCNGC 3 cut(s) 44, 68, 112
BmsI GCATC 1 cut(s) 54
BpmI CTGGAG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 53
BseXI GCAGC 3 cut(s) 29, 53, 97
Bsp143I GATC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 54
BssMI GATC 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 62
BstKTI GATC 1 cut(s) 173
BstMBI GATC 1 cut(s) 170
BstV1I GCAGC 3 cut(s) 29, 53, 97
BstX2I RGATCY 1 cut(s) 170
BstYI RGATCY 1 cut(s) 170
CviJI RGCY 3 cut(s) 42, 66, 110
CviKI_1 RGCY 3 cut(s) 42, 66, 110
DdeI CTNAG 1 cut(s) 62
DpnI GATC 1 cut(s) 172
DpnII GATC 1 cut(s) 170
FaiI YATR 5 cut(s) 13, 29, 31, 33, 188
Fnu4HI GCNGC 3 cut(s) 43, 67, 111
Fsp4HI GCNGC 3 cut(s) 43, 67, 111
FspBI CTAG 2 cut(s) 17, 152
GluI GCNGC 3 cut(s) 43, 67, 111
GsuI CTGGAG 1 cut(s) 151
HinfI GANTC 1 cut(s) 164
HphI GGTGA 1 cut(s) 173
Hpy188I TCNGA 1 cut(s) 50
Hpy188III TCNNGA 2 cut(s) 86, 168
HpyAV CCTTC 1 cut(s) 152
HpyCH4V TGCA 2 cut(s) 45, 69
HpyF3I CTNAG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 170
LpnPI CCDG 3 cut(s) 71, 139, 181
Lsp1109I GCAGC 3 cut(s) 29, 53, 97
LweI GCATC 1 cut(s) 54
MaeI CTAG 2 cut(s) 17, 152
MaeIII GTNAC 2 cut(s) 128, 161
MalI GATC 1 cut(s) 172
MboI GATC 1 cut(s) 170
MflI RGATCY 1 cut(s) 170
MluCI AATT 1 cut(s) 89
MlyI GAGTC 1 cut(s) 158
MseI TTAA 1 cut(s) 180
NdeII GATC 1 cut(s) 170
NmuCI GTSAC 1 cut(s) 161
PkrI GCNGC 3 cut(s) 44, 68, 112
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
PsuI RGATCY 1 cut(s) 170
SaqAI TTAA 1 cut(s) 180
SatI GCNGC 3 cut(s) 43, 67, 111
Sau3AI GATC 1 cut(s) 170
SchI GAGTC 1 cut(s) 158
SetI ASST 4 cut(s) 44, 68, 128, 163
SfaNI GCATC 1 cut(s) 54
SgeI CNNG 8 cut(s) 19, 29, 88, 98, 118, 138, 164, 180
Sse9I AATT 1 cut(s) 89
SspMI CTAG 2 cut(s) 17, 152
TasI AATT 1 cut(s) 89
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TseFI GTSAC 1 cut(s) 161
TseI GCWGC 3 cut(s) 42, 66, 110
Tsp45I GTSAC 1 cut(s) 161
XspI CTAG 2 cut(s) 17, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.