RchiOBHm_Chr2g0100791

F-Box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0017219
Physical Location & Seq
Forward (+)
12598518 .. 12600054
1537 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 990 bp
ATGATCAGTAGTATTCTCGAATTGCTTAATACGTTCCAAAACATTTATACCGGACTAGGATTGGTTTGTTTGGTGATCTCCTTTGTTCTAGGATTGCTTTGGAGAGCGTTTGTTCTGGTGATTTCTGCTTTGGGTGTATGGATTTCCTATTTGATTTTGACAGACCATGATTGGCACGGGCTGTTTCTGACAGACGAAAAAGGCTTTGCACTTTTTGCAAGTGCTTGGCTTGGTTTACTGCTACTCTACCAAGCACAAAGTCTGCTTGCCAAAGTTTGCCTTTGCGGTATAGAAACCCTAGTAATATGGGTAATGTATTCGATGACGACTAATAAGGAAATCCCTTGGGATCATTCTAGTTTCCCTGAAATCATCTCCCGATCTATTGATCCGGTGCCCCATTATTCCTCTCCGTCAGACCTCTACCGCAGTCTCTGTGTTTCCCCCATCTTCCTTGACGAAGGCCATTTGAGCTTTGCGTATGATCGGGCGACTGGTAAAAAATGCTGGATGCTGGGAGCCAGGCTTTTACTTATTGATTTGGCAGAAATTCCAGAATACTGGAACTGGAGTTCTGTACCCGAATCCAGGTTCTCCCAAGTGGCTGAGCTCAGATTTGTATATAGTCTTAAGATCAAGGGATCTATAGCGACATATATGTTGTCCCCGAGAACAACTTATGTAGCTTACCTTGTATATAAGTTTCCAAATATATCTCGATCTGGTTTTCATGAAAGCCCTGTTAGCTTGCGTGTAGTGCGTGTAGTTAATATTCAACGCAGAGTTGTAGCTCAACATAATCGTGTCTTCCTGATAGGAGATATGGCTTCACAAGCTCGAAGGAGAAATGACGGATGGATGGAGATTGAGTTCGGTGAAATCTCCTATATTGAAGATAATGCTACTATAGAGTGTATTCTAGAGGGATCTGAAAGTTTTGTGAGAAAAAGAGGTCTCATTGTGGAAGGTATTGAGTTTAGGCCTAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box PP2

Protein Analysis

329

Amino Acids

37.6

Weight (kDa)

6.4

Isoelectric Point (pI)

63.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 167 - 328 8e-40 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017219)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g12730
rosa_chinensis RchiOBHm_Chr2g0100791
rosa_laevigata RLG00000017010
rosa_multiflora Rmu_sc0001187.1_g000001 Rmu_sc0001659.1_g000017
rosa_roxburghii Rroxscaffold_2G00141860
rosa_rugosa Rorug02G0092700 Rorug02G0092700 Rorug02G0092800
rosa_samantha Rh2AG140500 Rh2BG145400 Rh2CG146300 Rh2DG145800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 394
AciI CCGC 2 cut(s) 285, 427
AclWI GGATC 4 cut(s) 357, 383, 649, 934
AcsI RAATTY 1 cut(s) 549
AfaI GTAC 1 cut(s) 579
AfiI CCNNNNNNNGG 1 cut(s) 588
AflII CTTAAG 1 cut(s) 629
AgsI TTSAA 2 cut(s) 776, 893
AjnI CCWGG 2 cut(s) 521, 587
AloI GAACNNNNNNTCC 4 cut(s) 556, 588, 854, 886
AluBI AGCT 6 cut(s) 474, 610, 686, 747, 791, 836
AluI AGCT 6 cut(s) 474, 610, 686, 747, 791, 836
Alw21I GWGCWC 1 cut(s) 612
Alw26I GTCTC 2 cut(s) 437, 959
AlwI GGATC 4 cut(s) 357, 383, 649, 934
AlwNI CAGNNNCTG 1 cut(s) 435
Ama87I CYCGRG 1 cut(s) 667
AoxI GGCC 2 cut(s) 463, 980
ApoI RAATTY 1 cut(s) 549
AsuHPI GGTGA 3 cut(s) 85, 130, 887
AvaI CYCGRG 1 cut(s) 667
BaeGI GKGCMC 1 cut(s) 399
BanI GGYRCC 1 cut(s) 394
BanII GRGCYC 1 cut(s) 612
BbsI GAAGAC 1 cut(s) 799
Bbv12I GWGCWC 1 cut(s) 612
BccI CCATC 3 cut(s) 455, 849, 853
BciT130I CCWGG 2 cut(s) 523, 589
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 2 cut(s) 437, 959
BfaI CTAG 6 cut(s) 56, 89, 299, 357, 920, 984
BfmI CTRYAG 2 cut(s) 645, 906
BfrI CTTAAG 1 cut(s) 629
BlpI GCTNAGC 1 cut(s) 606
Bme1390I CCNGG 2 cut(s) 523, 589
BmeT110I CYCGRG 1 cut(s) 667
BmiI GGNNCC 2 cut(s) 396, 520
BmrFI CCNGG 2 cut(s) 523, 589
BmsI GCATC 1 cut(s) 501
BpiI GAAGAC 1 cut(s) 799
BpmI CTGGAG 1 cut(s) 589
Bpu1102I GCTNAGC 1 cut(s) 606
BsaI GGTCTC 1 cut(s) 959
BsaJI CCNNGG 1 cut(s) 344
BsaWI WCCGGW 2 cut(s) 50, 391
BsaXI ACNNNNNCTCC 2 cut(s) 854, 884
Bsc4I CCNNNNNNNGG 1 cut(s) 588
Bse1I ACTGG 3 cut(s) 499, 566, 572
BseBI CCWGG 2 cut(s) 523, 589
BseDI CCNNGG 1 cut(s) 344
BseGI GGATG 3 cut(s) 516, 860, 864
BseLI CCNNNNNNNGG 1 cut(s) 588
BseMII CTCAG 2 cut(s) 597, 625
BseNI ACTGG 3 cut(s) 499, 566, 572
BseSI GKGCMC 1 cut(s) 399
BseYI CCCAGC 1 cut(s) 514
BshFI GGCC 2 cut(s) 465, 982
BshNI GGYRCC 1 cut(s) 394
BsiHKAI GWGCWC 1 cut(s) 612
BsiHKCI CYCGRG 1 cut(s) 667
BsiSI CCGG 2 cut(s) 51, 392
BslFI GGGAC 1 cut(s) 649
BslI CCNNNNNNNGG 1 cut(s) 588
BsmAI GTCTC 2 cut(s) 437, 959
BsmFI GGGAC 1 cut(s) 649
BsnI GGCC 2 cut(s) 465, 982
Bso31I GGTCTC 1 cut(s) 959
BsoBI CYCGRG 1 cut(s) 667
Bsp1286I GDGCHC 2 cut(s) 399, 612
Bsp1720I GCTNAGC 1 cut(s) 606
BspACI CCGC 2 cut(s) 285, 427
BspANI GGCC 2 cut(s) 465, 982
BspCNI CTCAG 2 cut(s) 598, 624
BspHI TCATGA 1 cut(s) 730
BspLI GGNNCC 2 cut(s) 396, 520
BspPI GGATC 4 cut(s) 357, 383, 649, 934
BspT107I GGYRCC 1 cut(s) 394
BspTI CTTAAG 1 cut(s) 629
BspTNI GGTCTC 1 cut(s) 959
BsrI ACTGG 3 cut(s) 499, 566, 572
BssECI CCNNGG 1 cut(s) 344
BssT1I CCWWGG 1 cut(s) 344
Bst2UI CCWGG 2 cut(s) 523, 589
BstAFI CTTAAG 1 cut(s) 629
BstAPI GCANNNNNTGC 1 cut(s) 215
BstC8I GCNNGC 2 cut(s) 267, 749
BstDEI CTNAG 2 cut(s) 606, 611
BstF5I GGATG 3 cut(s) 516, 860, 864
BstMAI GTCTC 2 cut(s) 437, 959
BstMWI GCNNNNNNNGC 5 cut(s) 215, 471, 744, 757, 833
BstNI CCWGG 2 cut(s) 523, 589
BstSCI CCNGG 2 cut(s) 521, 587
BstSFI CTRYAG 2 cut(s) 645, 906
BstSLI GKGCMC 1 cut(s) 399
BstV2I GAAGAC 1 cut(s) 799
BstX2I RGATCY 2 cut(s) 641, 926
BstXI CCANNNNNNTGG 1 cut(s) 561
BstYI RGATCY 2 cut(s) 641, 926
BsuRI GGCC 2 cut(s) 465, 982
BtsCI GGATG 3 cut(s) 516, 860, 864
Cac8I GCNNGC 2 cut(s) 267, 749
CaiI CAGNNNCTG 1 cut(s) 435
CciI TCATGA 1 cut(s) 730
Csp6I GTAC 1 cut(s) 578
CviAII CATG 2 cut(s) 167, 731
CviQI GTAC 1 cut(s) 578
DdeI CTNAG 2 cut(s) 606, 611
Ecl136II GAGCTC 1 cut(s) 610
Eco130I CCWWGG 1 cut(s) 344
Eco147I AGGCCT 1 cut(s) 982
Eco24I GRGCYC 1 cut(s) 612
Eco31I GGTCTC 1 cut(s) 959
Eco53kI GAGCTC 1 cut(s) 610
Eco88I CYCGRG 1 cut(s) 667
EcoICRI GAGCTC 1 cut(s) 610
EcoRII CCWGG 2 cut(s) 521, 587
EcoT14I CCWWGG 1 cut(s) 344
EcoT38I GRGCYC 1 cut(s) 612
ErhI CCWWGG 1 cut(s) 344
FaeI CATG 2 cut(s) 170, 734
FalI AAGNNNNNCTT 2 cut(s) 264, 296
FaqI GGGAC 1 cut(s) 649
FatI CATG 2 cut(s) 166, 730
FbaI TGATCA 1 cut(s) 3
FokI GGATG 3 cut(s) 523, 867, 871
FriOI GRGCYC 1 cut(s) 612
FspBI CTAG 6 cut(s) 56, 89, 299, 357, 920, 984
GsaI CCCAGC 1 cut(s) 518
GsuI CTGGAG 1 cut(s) 589
HaeIII GGCC 2 cut(s) 465, 982
HapII CCGG 2 cut(s) 51, 392
Hin1II CATG 2 cut(s) 170, 734
HinfI GANTC 1 cut(s) 584
HpaII CCGG 2 cut(s) 51, 392
HphI GGTGA 3 cut(s) 85, 130, 887
Hpy166II GTNNAC 1 cut(s) 236
Hpy188I TCNGA 4 cut(s) 189, 418, 614, 931
Hpy188III TCNNGA 7 cut(s) 17, 378, 554, 717, 731, 811, 920
Hpy8I GTNNAC 1 cut(s) 236
HpyAV CCTTC 3 cut(s) 455, 834, 959
HpyCH4IV ACGT 1 cut(s) 32
HpyCH4V TGCA 2 cut(s) 209, 218
HpyF10VI GCNNNNNNNGC 5 cut(s) 215, 471, 744, 757, 833
HpyF3I CTNAG 2 cut(s) 606, 611
HpySE526I ACGT 1 cut(s) 32
Hsp92II CATG 2 cut(s) 170, 734
Ksp22I TGATCA 1 cut(s) 3
LmnI GCTCC 1 cut(s) 518
LweI GCATC 1 cut(s) 501
MaeI CTAG 6 cut(s) 56, 89, 299, 357, 920, 984
MaeII ACGT 1 cut(s) 32
MboII GAAGA 3 cut(s) 442, 799, 905
MflI RGATCY 2 cut(s) 641, 926
MhlI GDGCHC 2 cut(s) 399, 612
MluCI AATT 2 cut(s) 20, 549
MnlI CCTC 4 cut(s) 418, 431, 916, 944
MseI TTAA 3 cut(s) 27, 630, 768
MslI CAYNNNNRTG 1 cut(s) 801
MspCI CTTAAG 1 cut(s) 629
MspI CCGG 2 cut(s) 51, 392
MspR9I CCNGG 2 cut(s) 523, 589
MvaI CCWGG 2 cut(s) 523, 589
MwoI GCNNNNNNNGC 5 cut(s) 215, 471, 744, 757, 833
NlaIII CATG 2 cut(s) 170, 734
NlaIV GGNNCC 2 cut(s) 396, 520
PagI TCATGA 1 cut(s) 730
PceI AGGCCT 1 cut(s) 982
PfeI GAWTC 1 cut(s) 584
Psp124BI GAGCTC 1 cut(s) 612
Psp6I CCWGG 2 cut(s) 521, 587
PspFI CCCAGC 1 cut(s) 514
PspGI CCWGG 2 cut(s) 521, 587
PspN4I GGNNCC 2 cut(s) 396, 520
PstNI CAGNNNCTG 1 cut(s) 435
PsuI RGATCY 2 cut(s) 641, 926
RsaI GTAC 1 cut(s) 579
RsaNI GTAC 1 cut(s) 578
RseI CAYNNNNRTG 1 cut(s) 801
SacI GAGCTC 1 cut(s) 612
SaqAI TTAA 3 cut(s) 27, 630, 768
ScrFI CCNGG 2 cut(s) 523, 589
SduI GDGCHC 2 cut(s) 399, 612
SfaNI GCATC 1 cut(s) 501
SfcI CTRYAG 2 cut(s) 645, 906
SmiMI CAYNNNNRTG 1 cut(s) 801
SmlI CTYRAG 1 cut(s) 629
SmoI CTYRAG 1 cut(s) 629
Sse9I AATT 2 cut(s) 20, 549
SseBI AGGCCT 1 cut(s) 982
SsiI CCGC 2 cut(s) 285, 427
SspI AATATT 1 cut(s) 772
SspMI CTAG 6 cut(s) 56, 89, 299, 357, 920, 984
SstI GAGCTC 1 cut(s) 612
StuI AGGCCT 1 cut(s) 982
StyD4I CCNGG 2 cut(s) 521, 587
StyI CCWWGG 1 cut(s) 344
TaiI ACGT 1 cut(s) 35
TaqI TCGA 4 cut(s) 18, 320, 718, 838
TasI AATT 2 cut(s) 20, 549
TfiI GAWTC 1 cut(s) 584
Tru1I TTAA 3 cut(s) 27, 630, 768
Tru9I TTAA 3 cut(s) 27, 630, 768
TspDTI ATGAA 2 cut(s) 719, 747
TspGWI ACGGA 2 cut(s) 402, 867
Vha464I CTTAAG 1 cut(s) 629
XapI RAATTY 1 cut(s) 549
XbaI TCTAGA 1 cut(s) 919
XspI CTAG 6 cut(s) 56, 89, 299, 357, 920, 984
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.