RchiOBHm_Chr2g0107571

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
18921285 .. 18921628
344 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGGAGGCTTATCAATCAAATTTGTTGGGAATCGATTTATGTTTCAATTTTGATAGTGAAATAGATTGTAATCATTACCTACATGGAGGATCATGGTTTTATCGTAACATCATGCTGCTACTAGCTCCGTATGACAGAATCTGGGATGTTGAAACAATTCCGATCCATTCCCTCGAACTCTGTATCACGCTACTTTACGGTTCTGAGGCTTGA

Protein Analysis

70

Amino Acids

8.16

Weight (kDa)

4.27

Isoelectric Point (pI)

47.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 97, 157
AcsI RAATTY 1 cut(s) 19
AgsI TTSAA 2 cut(s) 46, 152
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
AlwI GGATC 2 cut(s) 97, 157
AlwNI CAGNNNCTG 1 cut(s) 141
ApeKI GCWGC 1 cut(s) 115
ApoI RAATTY 1 cut(s) 19
Asp700I GAANNNNTTC 1 cut(s) 156
BbvI GCAGC 1 cut(s) 102
BfaI CTAG 1 cut(s) 122
BisI GCNGC 1 cut(s) 116
BlsI GCNGC 1 cut(s) 117
Bsa29I ATCGAT 1 cut(s) 33
BsaBI GATNNNNATC 1 cut(s) 69
Bse8I GATNNNNATC 1 cut(s) 69
BseCI ATCGAT 1 cut(s) 33
BseGI GGATG 1 cut(s) 151
BseJI GATNNNNATC 1 cut(s) 69
BseMII CTCAG 1 cut(s) 195
BseXI GCAGC 1 cut(s) 102
BshVI ATCGAT 1 cut(s) 33
Bsp143I GATC 2 cut(s) 89, 162
BspCNI CTCAG 1 cut(s) 196
BspDI ATCGAT 1 cut(s) 33
BspPI GGATC 2 cut(s) 97, 157
BssMI GATC 2 cut(s) 89, 162
Bst4CI ACNGT 1 cut(s) 200
BstDEI CTNAG 1 cut(s) 204
BstF5I GGATG 1 cut(s) 151
BstKTI GATC 2 cut(s) 92, 165
BstMBI GATC 2 cut(s) 89, 162
BstV1I GCAGC 1 cut(s) 102
Bsu15I ATCGAT 1 cut(s) 33
BsuTUI ATCGAT 1 cut(s) 33
BtsCI GGATG 1 cut(s) 151
CaiI CAGNNNCTG 1 cut(s) 141
ClaI ATCGAT 1 cut(s) 33
CviAII CATG 3 cut(s) 83, 93, 112
CviJI RGCY 3 cut(s) 8, 125, 209
CviKI_1 RGCY 3 cut(s) 8, 125, 209
DdeI CTNAG 1 cut(s) 204
DpnI GATC 2 cut(s) 91, 164
DpnII GATC 2 cut(s) 89, 162
FaeI CATG 3 cut(s) 86, 96, 115
FaiI YATR 5 cut(s) 40, 84, 94, 113, 132
FatI CATG 3 cut(s) 82, 92, 111
Fnu4HI GCNGC 1 cut(s) 116
FokI GGATG 1 cut(s) 158
Fsp4HI GCNGC 1 cut(s) 116
FspBI CTAG 1 cut(s) 122
GluI GCNGC 1 cut(s) 116
Hin1II CATG 3 cut(s) 86, 96, 115
HinfI GANTC 2 cut(s) 30, 138
Hpy188I TCNGA 2 cut(s) 162, 205
HpyCH4III ACNGT 1 cut(s) 200
HpyF3I CTNAG 1 cut(s) 204
Hsp92II CATG 3 cut(s) 86, 96, 115
Kzo9I GATC 2 cut(s) 89, 162
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 1 cut(s) 127
Lsp1109I GCAGC 1 cut(s) 102
MaeI CTAG 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 104
MalI GATC 2 cut(s) 91, 164
MboI GATC 2 cut(s) 89, 162
MluCI AATT 3 cut(s) 19, 46, 156
MnlI CCTC 3 cut(s) 80, 182, 199
MroXI GAANNNNTTC 1 cut(s) 156
NdeII GATC 2 cut(s) 89, 162
NlaIII CATG 3 cut(s) 86, 96, 115
PdmI GAANNNNTTC 1 cut(s) 156
PfeI GAWTC 2 cut(s) 30, 138
PkrI GCNGC 1 cut(s) 117
PstNI CAGNNNCTG 1 cut(s) 141
SatI GCNGC 1 cut(s) 116
Sau3AI GATC 2 cut(s) 89, 162
SetI ASST 2 cut(s) 81, 127
SgeI CNNG 7 cut(s) 95, 105, 124, 134, 154, 185, 199
Sse9I AATT 3 cut(s) 19, 46, 156
SspMI CTAG 1 cut(s) 122
TaaI ACNGT 1 cut(s) 200
TaqI TCGA 2 cut(s) 33, 174
TasI AATT 3 cut(s) 19, 46, 156
TfiI GAWTC 2 cut(s) 30, 138
TseI GCWGC 1 cut(s) 115
TspGWI ACGGA 1 cut(s) 117
XapI RAATTY 1 cut(s) 19
XmnI GAANNNNTTC 1 cut(s) 156
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.