RchiOBHm_Chr2g0108291

phosphatase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
19731401 .. 19731685
285 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
ATGACCCTCTTGATGGCTTTCTGTGATTACTTGGGGAACTGTATAAAGGATGTGGTATCAGCTCCTAGACTTAGTTGCCCTCCTGTTATGAGAATAACAGCTACAAAAGATGAGGAGGATAATGAATTGGAATATGGAGTGCCATCTTCGATCTCACCAAAAATTATGTTTGCTTCTCTCGATACCTTTTGCATTGCATCCTATCTTATGCTCAGAATGAAGGTGTCTCTGAAATTTGGGTTTAGACATTGTATCTGGGGTCCAGCAAACATACCATCTAATTAA

Protein Analysis

94

Amino Acids

10.51

Weight (kDa)

6.53

Isoelectric Point (pI)

44.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 233
AfiI CCNNNNNNNGG 1 cut(s) 13
AluBI AGCT 2 cut(s) 62, 101
AluI AGCT 2 cut(s) 62, 101
Alw26I GTCTC 1 cut(s) 231
ApoI RAATTY 1 cut(s) 233
AspS9I GGNCC 1 cut(s) 260
AsuHPI GGTGA 1 cut(s) 147
AvaII GGWCC 1 cut(s) 260
BccI CCATC 3 cut(s) 7, 151, 283
BcoDI GTCTC 1 cut(s) 231
BfaI CTAG 1 cut(s) 66
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 260
BmiI GGNNCC 1 cut(s) 261
BmsI GCATC 1 cut(s) 206
Bsc4I CCNNNNNNNGG 1 cut(s) 13
Bse3DI GCAATG 1 cut(s) 192
BseGI GGATG 2 cut(s) 55, 197
BseLI CCNNNNNNNGG 1 cut(s) 13
BseMI GCAATG 1 cut(s) 192
BseMII CTCAG 1 cut(s) 226
BseRI GAGGAG 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 13
BsmAI GTCTC 1 cut(s) 231
Bsp143I GATC 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 225
BspLI GGNNCC 1 cut(s) 261
BsrDI GCAATG 1 cut(s) 192
BssMI GATC 1 cut(s) 150
Bst4CI ACNGT 1 cut(s) 41
BstDEI CTNAG 2 cut(s) 71, 212
BstF5I GGATG 2 cut(s) 55, 197
BstKTI GATC 1 cut(s) 153
BstMAI GTCTC 1 cut(s) 231
BstMBI GATC 1 cut(s) 150
BtsCI GGATG 2 cut(s) 55, 197
Cfr13I GGNCC 1 cut(s) 260
CviJI RGCY 3 cut(s) 17, 62, 101
CviKI_1 RGCY 3 cut(s) 17, 62, 101
DdeI CTNAG 2 cut(s) 71, 212
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 260
FaiI YATR 6 cut(s) 44, 89, 135, 167, 209, 272
FokI GGATG 2 cut(s) 62, 184
FspBI CTAG 1 cut(s) 66
HphI GGTGA 1 cut(s) 147
Hpy188I TCNGA 2 cut(s) 215, 231
Hpy188III TCNNGA 2 cut(s) 10, 179
HpyAV CCTTC 1 cut(s) 214
HpyCH4III ACNGT 1 cut(s) 41
HpyCH4V TGCA 2 cut(s) 192, 197
HpyF3I CTNAG 2 cut(s) 71, 212
Kzo9I GATC 1 cut(s) 150
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 3 cut(s) 96, 241, 276
LweI GCATC 1 cut(s) 206
MaeI CTAG 1 cut(s) 66
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 1 cut(s) 138
MluCI AATT 4 cut(s) 125, 162, 233, 280
MnlI CCTC 4 cut(s) 17, 90, 106, 109
MseI TTAA 1 cut(s) 283
NdeII GATC 1 cut(s) 150
NlaIV GGNNCC 1 cut(s) 261
PspN4I GGNNCC 1 cut(s) 261
PspPI GGNCC 1 cut(s) 260
SaqAI TTAA 1 cut(s) 283
Sau3AI GATC 1 cut(s) 150
Sau96I GGNCC 1 cut(s) 260
SetI ASST 4 cut(s) 64, 103, 188, 225
SfaNI GCATC 1 cut(s) 206
SgeI CNNG 7 cut(s) 22, 43, 78, 95, 191, 268, 275
SinI GGWCC 1 cut(s) 260
Sse9I AATT 4 cut(s) 125, 162, 233, 280
SspMI CTAG 1 cut(s) 66
TaaI ACNGT 1 cut(s) 41
TaqI TCGA 2 cut(s) 149, 180
TasI AATT 4 cut(s) 125, 162, 233, 280
Tru1I TTAA 1 cut(s) 283
Tru9I TTAA 1 cut(s) 283
TspDTI ATGAA 2 cut(s) 138, 233
VpaK11BI GGWCC 1 cut(s) 260
XapI RAATTY 1 cut(s) 233
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.