RchiOBHm_Chr2g0111811

KIP1-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
23405589 .. 23409044
3456 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGGCAACCTTGTTACAGTCTGAGTCCAGACGCTTGTATTCTTGGTGGTGGGACAGTCACATTAGCCCAAAGAACTCAAAATGGCTTCAAGAAAATCTTACAGATATGGATGCTAAAGTCAAAGCAATGATCACCCTTGTAAAATGGTTATTTTGA

Protein Analysis

51

Amino Acids

6.18

Weight (kDa)

9.3

Isoelectric Point (pI)

83.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KIP1 PF07765 14 - 48 4.5e-14 KIP1-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018906)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 124
BclI TGATCA 1 cut(s) 129
BmsI GCATC 1 cut(s) 100
Bse3DI GCAATG 1 cut(s) 132
BseGI GGATG 1 cut(s) 115
BseMI GCAATG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 12
BslFI GGGAC 1 cut(s) 65
BsmFI GGGAC 1 cut(s) 65
Bsp143I GATC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 13
BsrDI GCAATG 1 cut(s) 132
BssMI GATC 1 cut(s) 129
Bst4CI ACNGT 2 cut(s) 18, 56
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 115
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BtsCI GGATG 1 cut(s) 115
CseI GACGC 1 cut(s) 39
CviJI RGCY 2 cut(s) 66, 85
CviKI_1 RGCY 2 cut(s) 66, 85
DdeI CTNAG 1 cut(s) 21
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
FaiI YATR 1 cut(s) 107
FalI AAGNNNNNCTT 2 cut(s) 81, 113
FaqI GGGAC 1 cut(s) 65
FbaI TGATCA 1 cut(s) 129
FokI GGATG 1 cut(s) 122
HgaI GACGC 1 cut(s) 39
HinfI GANTC 1 cut(s) 23
HphI GGTGA 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 2 cut(s) 27, 89
HpyCH4III ACNGT 2 cut(s) 18, 56
HpyF3I CTNAG 1 cut(s) 21
Ksp22I TGATCA 1 cut(s) 129
Kzo9I GATC 1 cut(s) 129
LpnPI CCDG 1 cut(s) 40
LweI GCATC 1 cut(s) 100
MaeIII GTNAC 2 cut(s) 12, 56
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MlyI GAGTC 1 cut(s) 32
NdeII GATC 1 cut(s) 129
NmuCI GTSAC 1 cut(s) 56
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
Sau3AI GATC 1 cut(s) 129
SchI GAGTC 1 cut(s) 32
SetI ASST 1 cut(s) 11
SfaNI GCATC 1 cut(s) 100
SgeI CNNG 6 cut(s) 22, 39, 46, 54, 101, 149
TaaI ACNGT 2 cut(s) 18, 56
TseFI GTSAC 1 cut(s) 56
Tsp45I GTSAC 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.