RchiOBHm_Chr2g0151951
TCP Family

Chaperonin CPN60-2

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
69431500 .. 69433333
1834 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGCTGTTAAAGTCACAACGGGGCAAAAAGGACGCAATTGTTCTGGAGCAAAGCTTTGGAGCTCCTAAAGTGACAAAGGATGGTGTCACTATAGCAAAGAGCATTGAGTTCAGAATTACATGCTCAAATTCCTTGAGCTTCCACATGAAGAAGAAACACATATCAAGTTGGCTTCTGATAGGGGATACAAGAGAAAGATATTGA

Protein Analysis

67

Amino Acids

7.62

Weight (kDa)

10.01

Isoelectric Point (pI)

29.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 127
AluBI AGCT 3 cut(s) 54, 62, 138
AluI AGCT 3 cut(s) 54, 62, 138
Alw21I GWGCWC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 127
BanII GRGCYC 1 cut(s) 64
Bbv12I GWGCWC 1 cut(s) 64
BccI CCATC 1 cut(s) 74
BciVI GTATCC 1 cut(s) 178
BfmI CTRYAG 1 cut(s) 90
BfuI GTATCC 1 cut(s) 178
BpmI CTGGAG 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 154
BseGI GGATG 1 cut(s) 85
BsiHKAI GWGCWC 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 64
BstF5I GGATG 1 cut(s) 85
BstNSI RCATGY 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 90
BsuI GTATCC 1 cut(s) 178
BtsCI GGATG 1 cut(s) 85
CseI GACGC 1 cut(s) 41
CviAII CATG 2 cut(s) 120, 145
CviJI RGCY 4 cut(s) 54, 62, 138, 172
CviKI_1 RGCY 4 cut(s) 54, 62, 138, 172
Ecl136II GAGCTC 1 cut(s) 62
Eco24I GRGCYC 1 cut(s) 64
Eco53kI GAGCTC 1 cut(s) 62
EcoICRI GAGCTC 1 cut(s) 62
EcoT38I GRGCYC 1 cut(s) 64
FaeI CATG 2 cut(s) 123, 148
FaiI YATR 4 cut(s) 92, 121, 146, 161
FatI CATG 2 cut(s) 119, 144
FokI GGATG 1 cut(s) 92
FriOI GRGCYC 1 cut(s) 64
GsuI CTGGAG 1 cut(s) 65
HgaI GACGC 1 cut(s) 41
Hin1II CATG 2 cut(s) 123, 148
HindIII AAGCTT 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 113, 177
Hpy188III TCNNGA 1 cut(s) 44
Hsp92II CATG 2 cut(s) 123, 148
LmnI GCTCC 3 cut(s) 46, 59, 67
LpnPI CCDG 1 cut(s) 29
MaeIII GTNAC 3 cut(s) 12, 70, 85
MboII GAAGA 2 cut(s) 160, 163
MfeI CAATTG 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 64
MluCI AATT 3 cut(s) 36, 114, 127
MseI TTAA 1 cut(s) 8
MunI CAATTG 1 cut(s) 36
NlaIII CATG 2 cut(s) 123, 148
NmuCI GTSAC 3 cut(s) 12, 70, 85
NspI RCATGY 1 cut(s) 123
Psp124BI GAGCTC 1 cut(s) 64
SacI GAGCTC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 8
SduI GDGCHC 1 cut(s) 64
SetI ASST 3 cut(s) 56, 64, 140
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 6 cut(s) 32, 56, 132, 145, 157, 177
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
Sse9I AATT 3 cut(s) 36, 114, 127
SstI GAGCTC 1 cut(s) 64
TasI AATT 3 cut(s) 36, 114, 127
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TseFI GTSAC 3 cut(s) 12, 70, 85
Tsp45I GTSAC 3 cut(s) 12, 70, 85
TspDTI ATGAA 1 cut(s) 161
XapI RAATTY 1 cut(s) 127
XceI RCATGY 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.