RchiOBHm_Chr1g0326891

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
15451458 .. 15451632
175 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55646

Sequence Viewer

Length: 168 bp
ATGTTGGTCTGGACTCTGGTGCAAAGCTTTAGATCTCCTAAAGTGACAAAGGATGGGATCACTGTAGCAAAGAGCTTTGGGTTCAGAAATACATGCTCAAATTCCTTGAGCTTTCAAATGAAAAAGAAACACAGATCAAGTGGACTTCTGATAGGGAATACAGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.09

Weight (kDa)

11.17

Isoelectric Point (pI)

33.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 65
AcsI RAATTY 1 cut(s) 100
AgsI TTSAA 1 cut(s) 116
AluBI AGCT 3 cut(s) 27, 75, 111
AluI AGCT 3 cut(s) 27, 75, 111
AlwI GGATC 1 cut(s) 65
ApoI RAATTY 1 cut(s) 100
BccI CCATC 1 cut(s) 47
BfmI CTRYAG 1 cut(s) 63
BglII AGATCT 1 cut(s) 32
BpuEI CTTGAG 1 cut(s) 127
BseGI GGATG 1 cut(s) 58
Bsp143I GATC 3 cut(s) 32, 57, 134
BspPI GGATC 1 cut(s) 65
BssMI GATC 3 cut(s) 32, 57, 134
Bst4CI ACNGT 1 cut(s) 64
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 3 cut(s) 35, 60, 137
BstMBI GATC 3 cut(s) 32, 57, 134
BstNSI RCATGY 1 cut(s) 96
BstSFI CTRYAG 1 cut(s) 63
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BtsCI GGATG 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 60
CviAII CATG 1 cut(s) 93
CviJI RGCY 3 cut(s) 27, 75, 111
CviKI_1 RGCY 3 cut(s) 27, 75, 111
DpnI GATC 3 cut(s) 34, 59, 136
DpnII GATC 3 cut(s) 32, 57, 134
FaeI CATG 1 cut(s) 96
FaiI YATR 1 cut(s) 94
FatI CATG 1 cut(s) 92
FokI GGATG 1 cut(s) 65
Hin1II CATG 1 cut(s) 96
HindIII AAGCTT 1 cut(s) 25
HinfI GANTC 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 143
Hpy188I TCNGA 2 cut(s) 86, 150
Hpy188III TCNNGA 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 22
Hsp92II CATG 1 cut(s) 96
Kzo9I GATC 3 cut(s) 32, 57, 134
LpnPI CCDG 2 cut(s) 2, 147
MaeIII GTNAC 1 cut(s) 43
MalI GATC 3 cut(s) 34, 59, 136
MboI GATC 3 cut(s) 32, 57, 134
MflI RGATCY 1 cut(s) 32
MluCI AATT 1 cut(s) 100
MlyI GAGTC 1 cut(s) 7
MseI TTAA 1 cut(s) 166
NdeII GATC 3 cut(s) 32, 57, 134
NlaIII CATG 1 cut(s) 96
NmuCI GTSAC 1 cut(s) 43
NspI RCATGY 1 cut(s) 96
PleI GAGTC 1 cut(s) 7
PpsI GAGTC 1 cut(s) 7
PsuI RGATCY 1 cut(s) 32
SaqAI TTAA 1 cut(s) 166
Sau3AI GATC 3 cut(s) 32, 57, 134
SchI GAGTC 1 cut(s) 7
SetI ASST 4 cut(s) 29, 77, 113, 166
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 5 cut(s) 22, 29, 105, 118, 150
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
Sse9I AATT 1 cut(s) 100
TaaI ACNGT 1 cut(s) 64
TasI AATT 1 cut(s) 100
Tru1I TTAA 1 cut(s) 166
Tru9I TTAA 1 cut(s) 166
TscAI CASTG 1 cut(s) 67
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 134
TspRI CASTG 1 cut(s) 67
XapI RAATTY 1 cut(s) 100
XceI RCATGY 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.