RchiOBHm_Chr1g0323521

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
10974430 .. 10974926
497 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGTACTTCAAATGCGGCGATGAGGTTGATGCACGCAAGGTGTTTGATAAAATGTTTGTGAGGAATTTGTACTCGTGGAACAACATGCTGTCTGGGTATGCGAAGATGAGGAATCTGAAGGAGGCCCGGAGCTTGTTTGATAAAATGCCTGAGAGGGATGTTGTGTCCTGGAACCTCCGCAACTCTCTATAA

Protein Analysis

63

Amino Acids

7.62

Weight (kDa)

9.51

Isoelectric Point (pI)

53.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 22 - 54 2.4e-07 PPR repeat family
PPR PF01535 24 - 53 2.1e-09 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 15, 178
AcsI RAATTY 1 cut(s) 64
AcuI CTGAAG 1 cut(s) 137
AfaI GTAC 2 cut(s) 5, 71
AgsI TTSAA 1 cut(s) 10
AjnI CCWGG 1 cut(s) 167
AluBI AGCT 1 cut(s) 132
AluI AGCT 1 cut(s) 132
AoxI GGCC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 124
AsuC2I CCSGG 1 cut(s) 127
BauI CACGAG 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 169
BcnI CCSGG 1 cut(s) 127
BisI GCNGC 1 cut(s) 16
BlsI GCNGC 1 cut(s) 17
Bme1390I CCNGG 2 cut(s) 127, 169
BmgT120I GGNCC 1 cut(s) 124
BmiI GGNNCC 1 cut(s) 173
BmrFI CCNGG 2 cut(s) 127, 169
BmsI GCATC 1 cut(s) 19
BpuMI CCSGG 1 cut(s) 127
BseBI CCWGG 1 cut(s) 169
BseGI GGATG 1 cut(s) 163
BseMII CTCAG 1 cut(s) 141
BshFI GGCC 1 cut(s) 125
BsiSI CCGG 1 cut(s) 127
BsnI GGCC 1 cut(s) 125
BspACI CCGC 2 cut(s) 15, 178
BspANI GGCC 1 cut(s) 125
BspCNI CTCAG 1 cut(s) 142
BspLI GGNNCC 1 cut(s) 173
BssSI CACGAG 1 cut(s) 73
Bst2BI CACGAG 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 150
BstF5I GGATG 1 cut(s) 163
BstNI CCWGG 1 cut(s) 169
BstNSI RCATGY 1 cut(s) 88
BstSCI CCNGG 2 cut(s) 125, 167
BsuRI GGCC 1 cut(s) 125
BtgZI GCGATG 1 cut(s) 33
BtsCI GGATG 1 cut(s) 163
Cac8I GCNNGC 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 124
Csp6I GTAC 2 cut(s) 4, 70
CviAII CATG 1 cut(s) 85
CviJI RGCY 2 cut(s) 125, 132
CviKI_1 RGCY 2 cut(s) 125, 132
CviQI GTAC 2 cut(s) 4, 70
DdeI CTNAG 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 167
FaeI CATG 1 cut(s) 88
FaiI YATR 3 cut(s) 86, 99, 190
FatI CATG 1 cut(s) 84
Fnu4HI GCNGC 1 cut(s) 16
FokI GGATG 1 cut(s) 170
Fsp4HI GCNGC 1 cut(s) 16
GluI GCNGC 1 cut(s) 16
HaeIII GGCC 1 cut(s) 125
HapII CCGG 1 cut(s) 127
Hin1II CATG 1 cut(s) 88
HinfI GANTC 1 cut(s) 112
HpaII CCGG 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 117
HpyAV CCTTC 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 1 cut(s) 88
LmnI GCTCC 1 cut(s) 129
LpnPI CCDG 5 cut(s) 78, 140, 154, 162, 181
LweI GCATC 1 cut(s) 19
MboII GAAGA 1 cut(s) 115
MluCI AATT 1 cut(s) 64
MnlI CCTC 6 cut(s) 16, 54, 102, 115, 147, 185
MspI CCGG 1 cut(s) 127
MspR9I CCNGG 2 cut(s) 127, 169
MvaI CCWGG 1 cut(s) 169
NciI CCSGG 1 cut(s) 127
NlaIII CATG 1 cut(s) 88
NlaIV GGNNCC 1 cut(s) 173
NspI RCATGY 1 cut(s) 88
PfeI GAWTC 1 cut(s) 112
PfoI TCCNGGA 1 cut(s) 167
PkrI GCNGC 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 167
PspGI CCWGG 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 173
PspPI GGNCC 1 cut(s) 124
RsaI GTAC 2 cut(s) 5, 71
RsaNI GTAC 2 cut(s) 4, 70
SatI GCNGC 1 cut(s) 16
Sau96I GGNCC 1 cut(s) 124
ScrFI CCNGG 2 cut(s) 127, 169
SetI ASST 4 cut(s) 27, 42, 134, 177
SfaNI GCATC 1 cut(s) 19
Sse9I AATT 1 cut(s) 64
SsiI CCGC 2 cut(s) 15, 178
StyD4I CCNGG 2 cut(s) 125, 167
TasI AATT 1 cut(s) 64
TatI WGTACW 2 cut(s) 3, 69
TauI GCSGC 1 cut(s) 18
TfiI GAWTC 1 cut(s) 112
XapI RAATTY 1 cut(s) 64
XceI RCATGY 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.