RchiOBHm_Chr6g0311141

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
68199560 .. 68199739
180 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ27980

Sequence Viewer

Length: 180 bp
ATGAAGCTGGCTCCTTTTGAGGGAGATATCGAGTTGAATGTGAAATTGATCGAAATGTATGGGAGGTGTGGGAGTATGAGGGATGCACGCAAGGTGTTTGATAGAATGCCTGAGAGAAATTTGAGTTTGTGGCATTCGATGATCAATGGGTATGCTTTGAATGGGAAAATCGGCAAGTGA

Protein Analysis

59

Amino Acids

6.8

Weight (kDa)

9.36

Isoelectric Point (pI)

42.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 2 cut(s) 37, 160
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
ApoI RAATTY 1 cut(s) 118
BclI TGATCA 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 12
BmsI GCATC 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 20
BseGI GGATG 1 cut(s) 88
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 20
BsmI GAATGC 2 cut(s) 111, 133
Bsp143I GATC 2 cut(s) 48, 141
BspCNI CTCAG 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 12
BssMI GATC 2 cut(s) 48, 141
BstC8I GCNNGC 2 cut(s) 9, 88
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 88
BstKTI GATC 2 cut(s) 51, 144
BstMBI GATC 2 cut(s) 48, 141
BtsCI GGATG 1 cut(s) 88
Cac8I GCNNGC 2 cut(s) 9, 88
CviJI RGCY 2 cut(s) 7, 11
CviKI_1 RGCY 2 cut(s) 7, 11
DdeI CTNAG 1 cut(s) 111
DpnI GATC 2 cut(s) 50, 143
DpnII GATC 2 cut(s) 48, 141
Eco32I GATATC 1 cut(s) 28
EcoRV GATATC 1 cut(s) 28
FaiI YATR 3 cut(s) 60, 77, 153
FbaI TGATCA 1 cut(s) 141
FokI GGATG 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 111
Ksp22I TGATCA 1 cut(s) 141
Kzo9I GATC 2 cut(s) 48, 141
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 1 cut(s) 123
LweI GCATC 1 cut(s) 73
MalI GATC 2 cut(s) 50, 143
MboI GATC 2 cut(s) 48, 141
MluCI AATT 2 cut(s) 44, 118
MnlI CCTC 3 cut(s) 13, 57, 72
Mva1269I GAATGC 2 cut(s) 111, 133
NdeII GATC 2 cut(s) 48, 141
NlaIV GGNNCC 1 cut(s) 12
PctI GAATGC 2 cut(s) 111, 133
PspN4I GGNNCC 1 cut(s) 12
Sau3AI GATC 2 cut(s) 48, 141
SetI ASST 3 cut(s) 9, 68, 96
SfaNI GCATC 1 cut(s) 73
SgeI CNNG 5 cut(s) 20, 43, 99, 103, 122
Sse9I AATT 2 cut(s) 44, 118
TaqI TCGA 3 cut(s) 30, 51, 137
TasI AATT 2 cut(s) 44, 118
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.