RchiOBHm_Chr1g0353501

Belongs to the cyclin family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
46721162 .. 46724704
3543 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGTTGGAACTAGTAGTTGTTGAATATGTCGATGAATTGTACAAGTTCTACAAACTTGAAGAGGATAACTACCGAGTTGGAGATTACTTGGACATTGATCAAGTCTGGGTTGAATGGGCAAGCATGCTGTCAAGTTTCAGATCACTAGTGTTGTATGTCTGTGGTAGATCAGTAGTTAGGAATCATTTTGTGCATATAGCTAGAACTCACTTTGGTGGCTGTAATGATTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

9.13

Weight (kDa)

4.93

Isoelectric Point (pI)

31.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018562)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 41
AgsI TTSAA 3 cut(s) 23, 59, 113
AhlI ACTAGT 2 cut(s) 10, 145
AleI CACNNNNGTG 1 cut(s) 213
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
BclI TGATCA 1 cut(s) 97
BcuI ACTAGT 2 cut(s) 10, 145
BfaI CTAG 3 cut(s) 11, 146, 201
Bsp1407I TGTACA 1 cut(s) 39
Bsp143I GATC 3 cut(s) 97, 140, 167
BspHI TCATGA 1 cut(s) 230
BsrGI TGTACA 1 cut(s) 39
BssMI GATC 3 cut(s) 97, 140, 167
Bst6I CTCTTC 1 cut(s) 54
BstAUI TGTACA 1 cut(s) 39
BstC8I GCNNGC 2 cut(s) 121, 125
BstKTI GATC 3 cut(s) 100, 143, 170
BstMBI GATC 3 cut(s) 97, 140, 167
BstNSI RCATGY 1 cut(s) 127
Cac8I GCNNGC 2 cut(s) 121, 125
CciI TCATGA 1 cut(s) 230
Csp6I GTAC 1 cut(s) 40
CviAII CATG 2 cut(s) 124, 231
CviJI RGCY 2 cut(s) 200, 219
CviKI_1 RGCY 2 cut(s) 200, 219
CviQI GTAC 1 cut(s) 40
DpnI GATC 3 cut(s) 99, 142, 169
DpnII GATC 3 cut(s) 97, 140, 167
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
FaeI CATG 2 cut(s) 127, 234
FaiI YATR 6 cut(s) 27, 125, 156, 195, 197, 232
FatI CATG 2 cut(s) 123, 230
FbaI TGATCA 1 cut(s) 97
FspBI CTAG 3 cut(s) 11, 146, 201
Hin1II CATG 2 cut(s) 127, 234
HinfI GANTC 2 cut(s) 181, 227
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 193
Hsp92II CATG 2 cut(s) 127, 234
Ksp22I TGATCA 1 cut(s) 97
Kzo9I GATC 3 cut(s) 97, 140, 167
LpnPI CCDG 1 cut(s) 91
MaeI CTAG 3 cut(s) 11, 146, 201
MalI GATC 3 cut(s) 99, 142, 169
MboI GATC 3 cut(s) 97, 140, 167
MboII GAAGA 1 cut(s) 71
MluCI AATT 1 cut(s) 35
MmeI TCCRAC 1 cut(s) 58
MnlI CCTC 1 cut(s) 55
MslI CAYNNNNRTG 1 cut(s) 213
NdeII GATC 3 cut(s) 97, 140, 167
NlaIII CATG 2 cut(s) 127, 234
NspI RCATGY 1 cut(s) 127
OliI CACNNNNGTG 1 cut(s) 213
PaeI GCATGC 1 cut(s) 127
PagI TCATGA 1 cut(s) 230
PfeI GAWTC 2 cut(s) 181, 227
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
RseI CAYNNNNRTG 1 cut(s) 213
Sau3AI GATC 3 cut(s) 97, 140, 167
SetI ASST 1 cut(s) 202
SmiMI CAYNNNNRTG 1 cut(s) 213
SpeI ACTAGT 2 cut(s) 10, 145
SphI GCATGC 1 cut(s) 127
Sse9I AATT 1 cut(s) 35
SspMI CTAG 3 cut(s) 11, 146, 201
TaqI TCGA 1 cut(s) 30
TasI AATT 1 cut(s) 35
TatI WGTACW 1 cut(s) 39
TfiI GAWTC 2 cut(s) 181, 227
TspDTI ATGAA 2 cut(s) 48, 219
XceI RCATGY 1 cut(s) 127
XspI CTAG 3 cut(s) 11, 146, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.