Rroxscaffold_5G00378580

Belongs to the cyclin family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
59033160 .. 59035785
2626 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00378580.1

Sequence Viewer

Length: 285 bp
ATGATCTATAAGTGCAACATCCAAGGAAAACCTGTTGTCACGACAATACGGATGTTGGAACTAGCAGTTGTTGAATATGTAGATGAATTGTACAAGTTCTACAAACTTGAAGAGGATGACTATCGAGTTGGAGATTACTTGGACATTGATCAAGTACGGGTTGAATGGGCAAGCATGCTGTCAAGTTTCAGATCACTAGTGTTGTATGTCCGTGGTAGATCAGTAGTTAGGAATCATTTTGTGCATATAGCTAGAACTCACTTTGGTGGCTGTAATGATTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

11.07

Weight (kDa)

6.26

Isoelectric Point (pI)

31.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018562)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 92, 156
AgsI TTSAA 3 cut(s) 74, 110, 164
AhlI ACTAGT 1 cut(s) 196
AleI CACNNNNGTG 1 cut(s) 264
AluBI AGCT 1 cut(s) 251
AluI AGCT 1 cut(s) 251
BclI TGATCA 1 cut(s) 148
BcuI ACTAGT 1 cut(s) 196
BfaI CTAG 3 cut(s) 62, 197, 252
BsaBI GATNNNNATC 1 cut(s) 120
BsaJI CCNNGG 2 cut(s) 22, 211
Bse8I GATNNNNATC 1 cut(s) 120
BseDI CCNNGG 2 cut(s) 22, 211
BseGI GGATG 3 cut(s) 18, 57, 121
BseJI GATNNNNATC 1 cut(s) 120
Bsp1407I TGTACA 1 cut(s) 90
Bsp143I GATC 4 cut(s) 3, 148, 191, 218
BspHI TCATGA 1 cut(s) 281
BsrGI TGTACA 1 cut(s) 90
BssECI CCNNGG 2 cut(s) 22, 211
BssMI GATC 4 cut(s) 3, 148, 191, 218
BssT1I CCWWGG 1 cut(s) 22
Bst6I CTCTTC 1 cut(s) 105
BstAUI TGTACA 1 cut(s) 90
BstC8I GCNNGC 2 cut(s) 172, 176
BstDSI CCRYGG 1 cut(s) 211
BstF5I GGATG 3 cut(s) 18, 57, 121
BstKTI GATC 4 cut(s) 6, 151, 194, 221
BstMBI GATC 4 cut(s) 3, 148, 191, 218
BstNSI RCATGY 1 cut(s) 178
BtgI CCRYGG 1 cut(s) 211
BtsCI GGATG 3 cut(s) 18, 57, 121
Cac8I GCNNGC 2 cut(s) 172, 176
CciI TCATGA 1 cut(s) 281
Csp6I GTAC 2 cut(s) 91, 155
CviAII CATG 2 cut(s) 175, 282
CviJI RGCY 2 cut(s) 251, 270
CviKI_1 RGCY 2 cut(s) 251, 270
CviQI GTAC 2 cut(s) 91, 155
DpnI GATC 4 cut(s) 5, 150, 193, 220
DpnII GATC 4 cut(s) 3, 148, 191, 218
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Eco130I CCWWGG 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 22
ErhI CCWWGG 1 cut(s) 22
FaeI CATG 2 cut(s) 178, 285
FaiI YATR 7 cut(s) 9, 78, 176, 207, 246, 248, 283
FatI CATG 2 cut(s) 174, 281
FbaI TGATCA 1 cut(s) 148
FokI GGATG 3 cut(s) 5, 64, 128
FspBI CTAG 3 cut(s) 62, 197, 252
Hin1II CATG 2 cut(s) 178, 285
HinfI GANTC 2 cut(s) 232, 278
Hpy188I TCNGA 1 cut(s) 191
Hpy188III TCNNGA 2 cut(s) 40, 282
HpyCH4V TGCA 2 cut(s) 15, 244
Hsp92II CATG 2 cut(s) 178, 285
Ksp22I TGATCA 1 cut(s) 148
Kzo9I GATC 4 cut(s) 3, 148, 191, 218
LpnPI CCDG 1 cut(s) 45
MaeI CTAG 3 cut(s) 62, 197, 252
MaeIII GTNAC 1 cut(s) 37
MalI GATC 4 cut(s) 5, 150, 193, 220
MboI GATC 4 cut(s) 3, 148, 191, 218
MboII GAAGA 1 cut(s) 122
MluCI AATT 1 cut(s) 86
MmeI TCCRAC 2 cut(s) 36, 109
MnlI CCTC 1 cut(s) 106
MslI CAYNNNNRTG 1 cut(s) 264
NdeII GATC 4 cut(s) 3, 148, 191, 218
NlaIII CATG 2 cut(s) 178, 285
NmuCI GTSAC 1 cut(s) 37
NspI RCATGY 1 cut(s) 178
OliI CACNNNNGTG 1 cut(s) 264
PaeI GCATGC 1 cut(s) 178
PagI TCATGA 1 cut(s) 281
PfeI GAWTC 2 cut(s) 232, 278
RsaI GTAC 2 cut(s) 92, 156
RsaNI GTAC 2 cut(s) 91, 155
RseI CAYNNNNRTG 1 cut(s) 264
Sau3AI GATC 4 cut(s) 3, 148, 191, 218
SetI ASST 2 cut(s) 34, 253
SmiMI CAYNNNNRTG 1 cut(s) 264
SpeI ACTAGT 1 cut(s) 196
SphI GCATGC 1 cut(s) 178
Sse9I AATT 1 cut(s) 86
SspMI CTAG 3 cut(s) 62, 197, 252
StyI CCWWGG 1 cut(s) 22
TaqI TCGA 1 cut(s) 124
TasI AATT 1 cut(s) 86
TatI WGTACW 1 cut(s) 90
TfiI GAWTC 2 cut(s) 232, 278
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 2 cut(s) 99, 270
TspGWI ACGGA 2 cut(s) 64, 200
XceI RCATGY 1 cut(s) 178
XspI CTAG 3 cut(s) 62, 197, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.