Rh6DG315700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
51763065 .. 51764391
1327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG315700.1

Sequence Viewer

Length: 198 bp
ATGCAGAGATATTGGCTTTGGGATTCCTTCCAAATGCTGGCGTTGCTGTCGGCGTTTCCCAGTGAATCTTATTTCCAGCCTCCACAGAGTTTCCATGTTGCGGACAAAAGGGAGGACGTCTTAAGTTATCTGTTTAAAGCTTTCATGGAATTAAATACTTTCTACTTGGTTTCCCAAGCAAACCATCTAGCTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.74

Weight (kDa)

5.4

Isoelectric Point (pI)

53.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018562)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 120
AccB7I CCANNNNNTGG 1 cut(s) 37
AciI CCGC 1 cut(s) 101
AcyI GRCGYC 1 cut(s) 117
AfiI CCNNNNNNNGG 2 cut(s) 37, 100
AflII CTTAAG 1 cut(s) 121
AluBI AGCT 3 cut(s) 140, 191, 195
AluI AGCT 3 cut(s) 140, 191, 195
AsuNHI GCTAGC 1 cut(s) 191
BccI CCATC 1 cut(s) 192
BfaI CTAG 3 cut(s) 188, 192, 196
BfrI CTTAAG 1 cut(s) 121
BmrI ACTGGG 1 cut(s) 54
BmtI GCTAGC 1 cut(s) 195
BmuI ACTGGG 1 cut(s) 54
BsaHI GRCGYC 1 cut(s) 117
Bsc4I CCNNNNNNNGG 2 cut(s) 37, 100
Bse1I ACTGG 1 cut(s) 60
BseLI CCNNNNNNNGG 2 cut(s) 37, 100
BseNI ACTGG 1 cut(s) 60
BslI CCNNNNNNNGG 2 cut(s) 37, 100
BspACI CCGC 1 cut(s) 101
BspOI GCTAGC 1 cut(s) 195
BspTI CTTAAG 1 cut(s) 121
BsrI ACTGG 1 cut(s) 60
BssNI GRCGYC 1 cut(s) 117
BstACI GRCGYC 1 cut(s) 117
BstAFI CTTAAG 1 cut(s) 121
BstC8I GCNNGC 2 cut(s) 39, 193
BstMWI GCNNNNNNNGC 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 67
Cac8I GCNNGC 2 cut(s) 39, 193
CviAII CATG 2 cut(s) 95, 145
CviJI RGCY 5 cut(s) 16, 79, 140, 191, 195
CviKI_1 RGCY 5 cut(s) 16, 79, 140, 191, 195
DraI TTTAAA 1 cut(s) 136
FaeI CATG 2 cut(s) 98, 148
FaiI YATR 2 cut(s) 96, 146
FatI CATG 2 cut(s) 94, 144
FspBI CTAG 3 cut(s) 188, 192, 196
Hin1I GRCGYC 1 cut(s) 117
Hin1II CATG 2 cut(s) 98, 148
HindIII AAGCTT 1 cut(s) 138
HinfI GANTC 2 cut(s) 23, 65
HpyAV CCTTC 1 cut(s) 37
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 43
HpySE526I ACGT 1 cut(s) 117
Hsp92I GRCGYC 1 cut(s) 117
Hsp92II CATG 2 cut(s) 98, 148
LpnPI CCDG 3 cut(s) 23, 73, 89
MaeI CTAG 3 cut(s) 188, 192, 196
MaeII ACGT 1 cut(s) 117
MluCI AATT 1 cut(s) 149
MnlI CCTC 2 cut(s) 90, 106
MseI TTAA 3 cut(s) 122, 135, 152
MspCI CTTAAG 1 cut(s) 121
MwoI GCNNNNNNNGC 1 cut(s) 43
NheI GCTAGC 1 cut(s) 191
NlaIII CATG 2 cut(s) 98, 148
PfeI GAWTC 2 cut(s) 23, 65
PflMI CCANNNNNTGG 1 cut(s) 37
SaqAI TTAA 3 cut(s) 122, 135, 152
SetI ASST 4 cut(s) 120, 142, 193, 197
SgeI CNNG 7 cut(s) 50, 72, 88, 107, 157, 178, 188
SmlI CTYRAG 1 cut(s) 121
SmoI CTYRAG 1 cut(s) 121
Sse9I AATT 1 cut(s) 149
SsiI CCGC 1 cut(s) 101
SspMI CTAG 3 cut(s) 188, 192, 196
TaiI ACGT 1 cut(s) 120
TasI AATT 1 cut(s) 149
TfiI GAWTC 2 cut(s) 23, 65
Tru1I TTAA 3 cut(s) 122, 135, 152
Tru9I TTAA 3 cut(s) 122, 135, 152
TscAI CASTG 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 133
TspRI CASTG 1 cut(s) 67
Van91I CCANNNNNTGG 1 cut(s) 37
Vha464I CTTAAG 1 cut(s) 121
XspI CTAG 3 cut(s) 188, 192, 196
ZraI GACGTC 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.