Rh5DG131500

Pyruvate kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
12889758 .. 12893549
3792 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG131500.1

Sequence Viewer

Length: 327 bp
ATGGAAATTCCAATAGAAGAGATCTTTTTGGCTCAGAAAGTGATGATCTATAAGTGCAACATCCAAGGAAAACATGTTGTCACGACAATACAGATGTTGGAACTAGCAATTGTTGAATATGTCGATGAATTGTACAAGTTCTACAAACTTGAAGAGGATAACTACCGAGTTGGAGATTACTTGGACATTGATCAAGTCTGGGTTGAATGGGCAAGCATGCTGTCAAGTTTCAGATCACTAGTGTTGTATGTCTGTGGTAGATCAGTAGTTAGGAATCATTTTGTGCATATAGCTAGAACTCACTTTGGTGGCTGTAACGATTCATGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.71

Weight (kDa)

5.24

Isoelectric Point (pI)

36.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK PF00224 1 - 35 3.2e-09 Pyruvate kinase, barrel domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018562)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 6
AfaI GTAC 1 cut(s) 134
AflIII ACRYGT 1 cut(s) 73
AgsI TTSAA 3 cut(s) 116, 152, 206
AhlI ACTAGT 1 cut(s) 238
AleI CACNNNNGTG 1 cut(s) 306
AluBI AGCT 1 cut(s) 293
AluI AGCT 1 cut(s) 293
ApoI RAATTY 1 cut(s) 6
BclI TGATCA 1 cut(s) 190
BcuI ACTAGT 1 cut(s) 238
BfaI CTAG 3 cut(s) 104, 239, 294
BglII AGATCT 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 64
BseDI CCNNGG 1 cut(s) 64
BseGI GGATG 1 cut(s) 60
BseMII CTCAG 1 cut(s) 47
Bsp1407I TGTACA 1 cut(s) 132
Bsp143I GATC 5 cut(s) 21, 45, 190, 233, 260
BspCNI CTCAG 1 cut(s) 46
BspHI TCATGA 1 cut(s) 323
BsrGI TGTACA 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 64
BssMI GATC 5 cut(s) 21, 45, 190, 233, 260
BssT1I CCWWGG 1 cut(s) 64
Bst6I CTCTTC 2 cut(s) 12, 147
BstAUI TGTACA 1 cut(s) 132
BstC8I GCNNGC 2 cut(s) 214, 218
BstDEI CTNAG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 60
BstKTI GATC 5 cut(s) 24, 48, 193, 236, 263
BstMBI GATC 5 cut(s) 21, 45, 190, 233, 260
BstNSI RCATGY 2 cut(s) 77, 220
BstX2I RGATCY 1 cut(s) 21
BstYI RGATCY 1 cut(s) 21
BtsCI GGATG 1 cut(s) 60
Cac8I GCNNGC 2 cut(s) 214, 218
CciI TCATGA 1 cut(s) 323
Csp6I GTAC 1 cut(s) 133
CviAII CATG 3 cut(s) 74, 217, 324
CviJI RGCY 3 cut(s) 32, 293, 312
CviKI_1 RGCY 3 cut(s) 32, 293, 312
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 1 cut(s) 33
DpnI GATC 5 cut(s) 23, 47, 192, 235, 262
DpnII GATC 5 cut(s) 21, 45, 190, 233, 260
Eam1104I CTCTTC 2 cut(s) 12, 147
EarI CTCTTC 2 cut(s) 12, 147
Eco130I CCWWGG 1 cut(s) 64
EcoT14I CCWWGG 1 cut(s) 64
ErhI CCWWGG 1 cut(s) 64
FaeI CATG 3 cut(s) 77, 220, 327
FaiI YATR 8 cut(s) 51, 75, 120, 218, 249, 288, 290, 325
FatI CATG 3 cut(s) 73, 216, 323
FbaI TGATCA 1 cut(s) 190
FokI GGATG 1 cut(s) 47
FspBI CTAG 3 cut(s) 104, 239, 294
Hin1II CATG 3 cut(s) 77, 220, 327
HinfI GANTC 2 cut(s) 274, 320
Hpy188I TCNGA 2 cut(s) 36, 233
Hpy188III TCNNGA 2 cut(s) 82, 324
HpyCH4V TGCA 2 cut(s) 57, 286
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 3 cut(s) 77, 220, 327
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 5 cut(s) 21, 45, 190, 233, 260
LpnPI CCDG 1 cut(s) 184
MaeI CTAG 3 cut(s) 104, 239, 294
MaeIII GTNAC 2 cut(s) 79, 314
MalI GATC 5 cut(s) 23, 47, 192, 235, 262
MboI GATC 5 cut(s) 21, 45, 190, 233, 260
MboII GAAGA 2 cut(s) 29, 164
MfeI CAATTG 1 cut(s) 108
MflI RGATCY 1 cut(s) 21
MluCI AATT 3 cut(s) 6, 108, 128
MmeI TCCRAC 2 cut(s) 78, 151
MnlI CCTC 1 cut(s) 148
MslI CAYNNNNRTG 1 cut(s) 306
MunI CAATTG 1 cut(s) 108
NdeII GATC 5 cut(s) 21, 45, 190, 233, 260
NlaIII CATG 3 cut(s) 77, 220, 327
NmuCI GTSAC 1 cut(s) 79
NspI RCATGY 2 cut(s) 77, 220
OliI CACNNNNGTG 1 cut(s) 306
PaeI GCATGC 1 cut(s) 220
PagI TCATGA 1 cut(s) 323
PciI ACATGT 1 cut(s) 73
PfeI GAWTC 2 cut(s) 274, 320
PscI ACATGT 1 cut(s) 73
PsuI RGATCY 1 cut(s) 21
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
RseI CAYNNNNRTG 1 cut(s) 306
Sau3AI GATC 5 cut(s) 21, 45, 190, 233, 260
SetI ASST 1 cut(s) 295
SmiMI CAYNNNNRTG 1 cut(s) 306
SpeI ACTAGT 1 cut(s) 238
SphI GCATGC 1 cut(s) 220
Sse9I AATT 3 cut(s) 6, 108, 128
SspMI CTAG 3 cut(s) 104, 239, 294
StyI CCWWGG 1 cut(s) 64
TaqI TCGA 1 cut(s) 123
TasI AATT 3 cut(s) 6, 108, 128
TatI WGTACW 1 cut(s) 132
TfiI GAWTC 2 cut(s) 274, 320
TseFI GTSAC 1 cut(s) 79
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 2 cut(s) 141, 312
XapI RAATTY 1 cut(s) 6
XceI RCATGY 2 cut(s) 77, 220
XspI CTAG 3 cut(s) 104, 239, 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.