RchiOBHm_Chr1g0323151

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
10685648 .. 10688005
2358 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55308

Sequence Viewer

Length: 270 bp
ATGATGTTGACTGGGATACTGAAGATGAGCTTGAGATTGAAAACTTCACTTTATCTTCTTCAGGCTAGATCATCATCAGGACCGTCCCAAACCAAAGTTTCTGATCATTTTGTCAATATGGTTGCCAAAACCATCCCAGAACATGGACTTGAAGATGCAGATTCAATTCTTGAAACCCTCCTCTTATATAACGCTCTTGAAAGTAGTCCTCCAGAGCAACATTCTCTTCCGGAGTTATATTCTCCTCCAGAACAGTTGTCATGCCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.83

Weight (kDa)

5.15

Isoelectric Point (pI)

75.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019343)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 143
AccIII TCCGGA 1 cut(s) 229
AcuI CTGAAG 2 cut(s) 41, 44
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 5 cut(s) 40, 152, 165, 173, 200
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
Aor13HI TCCGGA 1 cut(s) 229
AspS9I GGNCC 1 cut(s) 80
AvaII GGWCC 1 cut(s) 80
BccI CCATC 1 cut(s) 140
BciVI GTATCC 1 cut(s) 9
BclI TGATCA 1 cut(s) 103
BfaI CTAG 1 cut(s) 66
BfuI GTATCC 1 cut(s) 9
Bme18I GGWCC 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 80
BmrI ACTGGG 1 cut(s) 21
BmsI GCATC 1 cut(s) 145
BmuI ACTGGG 1 cut(s) 21
BpmI CTGGAG 2 cut(s) 195, 231
BpuEI CTTGAG 1 cut(s) 52
BsaBI GATNNNNATC 1 cut(s) 73
BsaWI WCCGGW 1 cut(s) 229
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 16
Bse8I GATNNNNATC 1 cut(s) 73
BseAI TCCGGA 1 cut(s) 229
BseGI GGATG 1 cut(s) 132
BseJI GATNNNNATC 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 143
BseNI ACTGG 1 cut(s) 16
BseRI GAGGAG 2 cut(s) 170, 234
BsiSI CCGG 1 cut(s) 230
BslFI GGGAC 1 cut(s) 70
BslI CCNNNNNNNGG 1 cut(s) 143
BsmFI GGGAC 1 cut(s) 70
Bsp13I TCCGGA 1 cut(s) 229
Bsp143I GATC 2 cut(s) 68, 103
BspEI TCCGGA 1 cut(s) 229
BsrI ACTGG 1 cut(s) 16
BssMI GATC 2 cut(s) 68, 103
Bst4CI ACNGT 2 cut(s) 84, 255
Bst6I CTCTTC 1 cut(s) 231
BstF5I GGATG 1 cut(s) 132
BstKTI GATC 2 cut(s) 71, 106
BstMBI GATC 2 cut(s) 68, 103
BsuI GTATCC 1 cut(s) 9
BtsCI GGATG 1 cut(s) 132
Cfr13I GGNCC 1 cut(s) 80
CviAII CATG 2 cut(s) 143, 261
CviJI RGCY 2 cut(s) 30, 65
CviKI_1 RGCY 2 cut(s) 30, 65
DpnI GATC 2 cut(s) 70, 105
DpnII GATC 2 cut(s) 68, 103
Eam1104I CTCTTC 1 cut(s) 231
EarI CTCTTC 1 cut(s) 231
Eco47I GGWCC 1 cut(s) 80
Eco57I CTGAAG 2 cut(s) 41, 44
FaeI CATG 2 cut(s) 146, 264
FaiI YATR 6 cut(s) 119, 144, 187, 189, 238, 262
FalI AAGNNNNNCTT 2 cut(s) 14, 46
FaqI GGGAC 1 cut(s) 70
FatI CATG 2 cut(s) 142, 260
FbaI TGATCA 1 cut(s) 103
FokI GGATG 1 cut(s) 119
FspBI CTAG 1 cut(s) 66
GsuI CTGGAG 2 cut(s) 195, 231
HapII CCGG 1 cut(s) 230
Hin1II CATG 2 cut(s) 146, 264
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HinfI GANTC 1 cut(s) 161
HpaII CCGG 1 cut(s) 230
Hpy166II GTNNAC 1 cut(s) 9
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 6 cut(s) 78, 170, 197, 212, 230, 248
Hpy8I GTNNAC 1 cut(s) 9
HpyCH4III ACNGT 2 cut(s) 84, 255
HpyCH4V TGCA 1 cut(s) 158
Hsp92II CATG 2 cut(s) 146, 264
Kpn2I TCCGGA 1 cut(s) 229
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 2 cut(s) 68, 103
LpnPI CCDG 6 cut(s) 47, 63, 150, 225, 243, 261
LweI GCATC 1 cut(s) 145
MaeI CTAG 1 cut(s) 66
MalI GATC 2 cut(s) 70, 105
MboI GATC 2 cut(s) 68, 103
MboII GAAGA 5 cut(s) 34, 47, 50, 164, 218
MluCI AATT 1 cut(s) 165
MnlI CCTC 4 cut(s) 188, 191, 219, 255
MroI TCCGGA 1 cut(s) 229
MspI CCGG 1 cut(s) 230
NdeII GATC 2 cut(s) 68, 103
NlaIII CATG 2 cut(s) 146, 264
PfeI GAWTC 1 cut(s) 161
PflMI CCANNNNNTGG 1 cut(s) 143
PspPI GGNCC 1 cut(s) 80
Sau3AI GATC 2 cut(s) 68, 103
Sau96I GGNCC 1 cut(s) 80
SetI ASST 1 cut(s) 32
SfaNI GCATC 1 cut(s) 145
SinI GGWCC 1 cut(s) 80
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
Sse9I AATT 1 cut(s) 165
SspMI CTAG 1 cut(s) 66
TaaI ACNGT 2 cut(s) 84, 255
TasI AATT 1 cut(s) 165
TfiI GAWTC 1 cut(s) 161
Van91I CCANNNNNTGG 1 cut(s) 143
VpaK11BI GGWCC 1 cut(s) 80
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.