Rroxscaffold_5G00371700

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
53268090 .. 53272584
4495 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00371700.1

Sequence Viewer

Length: 285 bp
ATGGCCTTGAGAGGGTTCTCGATACCTCAATCACAGAGAAGTTGCGTGAAAGCCAAGATTGGGAAGCTACTGTTAACTATTGTCAGCGAACTCTTATTATTTGCACTTTCAGTTTTGACACCTCCACATTTGCAATTTCAAGGGATTGGTTTGCAAGCGGGAATGATAATAATAGAGCAAATGGCTACAAAATTTACCGTGATGATGTGGAGAGTGGTTCGTAGTAGTAGGTCCACGTCCACGTCCACCCAATACAAGCGTTCTAGGAAATCAAGCATGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.5

Weight (kDa)

11.65

Isoelectric Point (pI)

65.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019343)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 191
AfiI CCNNNNNNNGG 2 cut(s) 12, 60
AgsI TTSAA 1 cut(s) 140
AjiI CACGTC 2 cut(s) 237, 243
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 191
AspS9I GGNCC 1 cut(s) 231
AvaII GGWCC 1 cut(s) 231
BfaI CTAG 1 cut(s) 264
Bme18I GGWCC 1 cut(s) 231
BmgBI CACGTC 2 cut(s) 237, 243
BmgT120I GGNCC 1 cut(s) 231
BpuEI CTTGAG 1 cut(s) 28
Bsc4I CCNNNNNNNGG 2 cut(s) 12, 60
BseLI CCNNNNNNNGG 2 cut(s) 12, 60
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 2 cut(s) 12, 60
BsnI GGCC 1 cut(s) 5
BspACI CCGC 1 cut(s) 158
BspANI GGCC 1 cut(s) 5
Bst4CI ACNGT 2 cut(s) 72, 199
BstC8I GCNNGC 1 cut(s) 156
BsuRI GGCC 1 cut(s) 5
BtrI CACGTC 2 cut(s) 237, 243
Cac8I GCNNGC 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 231
CviAII CATG 1 cut(s) 277
CviJI RGCY 4 cut(s) 5, 53, 67, 185
CviKI_1 RGCY 4 cut(s) 5, 53, 67, 185
Eco47I GGWCC 1 cut(s) 231
FaeI CATG 1 cut(s) 280
FaiI YATR 2 cut(s) 278, 283
FatI CATG 1 cut(s) 276
FauI CCCGC 1 cut(s) 151
FspBI CTAG 1 cut(s) 264
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 280
HincII GTYRAC 1 cut(s) 75
HindII GTYRAC 1 cut(s) 75
HpaI GTTAAC 1 cut(s) 75
Hpy166II GTNNAC 4 cut(s) 75, 234, 240, 246
Hpy188III TCNNGA 1 cut(s) 19
Hpy8I GTNNAC 4 cut(s) 75, 234, 240, 246
HpyCH4III ACNGT 2 cut(s) 72, 199
HpyCH4IV ACGT 2 cut(s) 236, 242
HpyCH4V TGCA 3 cut(s) 104, 133, 154
HpySE526I ACGT 2 cut(s) 236, 242
Hsp92II CATG 1 cut(s) 280
KspAI GTTAAC 1 cut(s) 75
MaeI CTAG 1 cut(s) 264
MaeII ACGT 2 cut(s) 236, 242
MluCI AATT 2 cut(s) 134, 191
MnlI CCTC 3 cut(s) 5, 36, 132
MseI TTAA 1 cut(s) 74
NlaIII CATG 1 cut(s) 280
PspPI GGNCC 1 cut(s) 231
SaqAI TTAA 1 cut(s) 74
Sau96I GGNCC 1 cut(s) 231
SetI ASST 6 cut(s) 28, 69, 124, 233, 239, 245
SinI GGWCC 1 cut(s) 231
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
Sse9I AATT 2 cut(s) 134, 191
SsiI CCGC 1 cut(s) 158
SspMI CTAG 1 cut(s) 264
TaaI ACNGT 2 cut(s) 72, 199
TaiI ACGT 2 cut(s) 239, 245
TaqI TCGA 1 cut(s) 20
TasI AATT 2 cut(s) 134, 191
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
VpaK11BI GGWCC 1 cut(s) 231
XapI RAATTY 1 cut(s) 191
XspI CTAG 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.