RchiOBHm_Chr1g0347231

26S proteasome non-atpase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
39847930 .. 39848346
417 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57338

Sequence Viewer

Length: 126 bp
ATGGATGCGAAGCTAAACCAGCTGACTCACAACTTTGGGTGTTTCAAAGCGGTGCTGATCCGTAATGATTTTGCACTTAGGTTGAATCGTAAAGGCAACTCCTACTTTTATGAAACTGTGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

41

Amino Acids

4.81

Weight (kDa)

9.51

Isoelectric Point (pI)

16.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018561)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AclWI GGATC 1 cut(s) 52
AgsI TTSAA 2 cut(s) 46, 85
AluBI AGCT 2 cut(s) 13, 22
AluI AGCT 2 cut(s) 13, 22
AlwI GGATC 1 cut(s) 52
BseGI GGATG 1 cut(s) 10
Bsp143I GATC 1 cut(s) 57
BspACI CCGC 1 cut(s) 50
BspPI GGATC 1 cut(s) 52
BssMI GATC 1 cut(s) 57
Bst4CI ACNGT 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 77
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 19
BtsCI GGATG 1 cut(s) 10
CviAII CATG 1 cut(s) 123
CviJI RGCY 2 cut(s) 13, 22
CviKI_1 RGCY 2 cut(s) 13, 22
DdeI CTNAG 1 cut(s) 77
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
FaeI CATG 1 cut(s) 126
FaiI YATR 2 cut(s) 111, 124
FatI CATG 1 cut(s) 122
FokI GGATG 1 cut(s) 17
FspEI CC 8 cut(s) 21, 22, 32, 35, 64, 74, 78, 115
Hin1II CATG 1 cut(s) 126
HinfI GANTC 2 cut(s) 25, 85
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 77
Hsp92II CATG 1 cut(s) 126
Kzo9I GATC 1 cut(s) 57
LpnPI CCDG 1 cut(s) 32
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MlyI GAGTC 1 cut(s) 19
MspA1I CMGCKG 1 cut(s) 22
MwoI GCNNNNNNNGC 1 cut(s) 19
NdeII GATC 1 cut(s) 57
NlaIII CATG 1 cut(s) 126
PfeI GAWTC 1 cut(s) 85
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
PvuII CAGCTG 1 cut(s) 22
Sau3AI GATC 1 cut(s) 57
SchI GAGTC 1 cut(s) 19
SetI ASST 3 cut(s) 15, 24, 83
SgeI CNNG 1 cut(s) 31
SsiI CCGC 1 cut(s) 50
TaaI ACNGT 1 cut(s) 118
TfiI GAWTC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 126
TspGWI ACGGA 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.