Rh7DG158900

Isoamylase 3

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
14024737 .. 14025059
323 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG158900.1

Sequence Viewer

Length: 165 bp
ATGAAACTGTGCCATGATTATAATCATAATCAGAGTAGCAATCTAGAACGATGGAAGATGCTCCTCCGTACCCCATATTTGTACGATTCAAATGTCTCCAAATTCCCACTCTTTGCATCATCTTCACCATTTCGACAACTCAGGATGGTGCTTCATTGTGTATAA

Protein Analysis

54

Amino Acids

6.5

Weight (kDa)

9.51

Isoelectric Point (pI)

85.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018561)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 21
AcsI RAATTY 1 cut(s) 101
AfaI GTAC 2 cut(s) 70, 83
AgsI TTSAA 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 100
ApoI RAATTY 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 117
BccI CCATC 2 cut(s) 45, 139
BcoDI GTCTC 1 cut(s) 100
BfaI CTAG 1 cut(s) 44
BmsI GCATC 2 cut(s) 48, 125
BsaBI GATNNNNATC 1 cut(s) 21
Bse8I GATNNNNATC 1 cut(s) 21
BseGI GGATG 1 cut(s) 150
BseJI GATNNNNATC 1 cut(s) 21
BseMII CTCAG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 53
BsmAI GTCTC 1 cut(s) 100
BspCNI CTCAG 1 cut(s) 153
Bst4CI ACNGT 1 cut(s) 9
BstDEI CTNAG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 150
BstMAI GTCTC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 150
Csp6I GTAC 2 cut(s) 69, 82
CviAII CATG 1 cut(s) 14
CviQI GTAC 2 cut(s) 69, 82
DdeI CTNAG 1 cut(s) 140
FaeI CATG 1 cut(s) 17
FaiI YATR 5 cut(s) 15, 21, 27, 76, 163
FatI CATG 1 cut(s) 13
FokI GGATG 1 cut(s) 157
FspBI CTAG 1 cut(s) 44
Hin1II CATG 1 cut(s) 17
HinfI GANTC 1 cut(s) 86
HphI GGTGA 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 33
Hpy188III TCNNGA 2 cut(s) 44, 142
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4V TGCA 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 140
Hsp92II CATG 1 cut(s) 17
LmnI GCTCC 1 cut(s) 66
LpnPI CCDG 1 cut(s) 127
LweI GCATC 2 cut(s) 48, 125
MaeI CTAG 1 cut(s) 44
MboII GAAGA 2 cut(s) 67, 114
MluCI AATT 1 cut(s) 101
MnlI CCTC 1 cut(s) 74
NlaIII CATG 1 cut(s) 17
PfeI GAWTC 1 cut(s) 86
PsiI TTATAA 1 cut(s) 21
RsaI GTAC 2 cut(s) 70, 83
RsaNI GTAC 2 cut(s) 69, 82
SfaNI GCATC 2 cut(s) 48, 125
SgeI CNNG 3 cut(s) 26, 56, 154
Sse9I AATT 1 cut(s) 101
SspMI CTAG 1 cut(s) 44
TaaI ACNGT 1 cut(s) 9
TaqI TCGA 1 cut(s) 133
TasI AATT 1 cut(s) 101
TfiI GAWTC 1 cut(s) 86
TspDTI ATGAA 2 cut(s) 17, 143
TspGWI ACGGA 1 cut(s) 56
XapI RAATTY 1 cut(s) 101
XbaI TCTAGA 1 cut(s) 43
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.