RchiOBHm_Chr2g0095601

beta-galactosidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0019868
Physical Location & Seq
Reverse (-)
8552686 .. 8553036
351 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47057

Sequence Viewer

Length: 243 bp
ATGATGACATGGTATAAGGCAACTTTCAAAGCTCCCCTAGGAATTGAACCAGTCGCGATGGACTTTCACGGGTTGGGTAAGGGCCATGCTTGGGTGAACGGGCATAGCATTGGGCGATATTGGCCAAGCTACTTGGCTCCAAAGGATGGTTGTAGTGTTGAAGCTTGTGACTACCGTGGTGCATACGACAATAACAAAGATGGTAACAACATTTTTCTCAACCTAGATAATTTATTCAATTGA

Protein Analysis

80

Amino Acids

8.99

Weight (kDa)

6.23

Isoelectric Point (pI)

27.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BetaGal_gal-bd PF21467 2 - 43 5.4e-18 Beta-galactosidase, galactose-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019868)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0095601 RchiOBHm_Chr2g0095621
rosa_multiflora Rmu_co8127886.1_g000001 Rmu_sc0003026.1_g000002
rosa_roxburghii Rroxscaffold_2G00146160
rosa_samantha Rh2AG100500 Rh2DG101600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AccII CGCG 1 cut(s) 56
AcoI YGGCCR 1 cut(s) 122
AfiI CCNNNNNNNGG 2 cut(s) 91, 146
AgsI TTSAA 4 cut(s) 28, 47, 161, 238
AluBI AGCT 3 cut(s) 32, 129, 164
AluI AGCT 3 cut(s) 32, 129, 164
AoxI GGCC 2 cut(s) 82, 122
AspA2I CCTAGG 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 82
AsuHPI GGTGA 1 cut(s) 106
AvrII CCTAGG 1 cut(s) 37
BalI TGGCCA 1 cut(s) 124
BccI CCATC 3 cut(s) 52, 140, 194
BfaI CTAG 2 cut(s) 38, 224
BlnI CCTAGG 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 138
BsaJI CCNNGG 2 cut(s) 37, 175
Bsc4I CCNNNNNNNGG 2 cut(s) 91, 146
Bse1I ACTGG 1 cut(s) 50
BseDI CCNNGG 2 cut(s) 37, 175
BseGI GGATG 1 cut(s) 151
BseLI CCNNNNNNNGG 2 cut(s) 91, 146
BseNI ACTGG 1 cut(s) 50
Bsh1236I CGCG 1 cut(s) 56
BshFI GGCC 2 cut(s) 84, 124
BslI CCNNNNNNNGG 2 cut(s) 91, 146
BsnI GGCC 2 cut(s) 84, 124
Bsp68I TCGCGA 1 cut(s) 56
BspANI GGCC 2 cut(s) 84, 124
BspFNI CGCG 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 50
BssECI CCNNGG 2 cut(s) 37, 175
BssT1I CCWWGG 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 176
BstDSI CCRYGG 1 cut(s) 175
BstF5I GGATG 1 cut(s) 151
BstFNI CGCG 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstUI CGCG 1 cut(s) 56
BsuRI GGCC 2 cut(s) 84, 124
BtgI CCRYGG 1 cut(s) 175
BtgZI GCGATG 1 cut(s) 71
BtsCI GGATG 1 cut(s) 151
BtuMI TCGCGA 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 82
CviAII CATG 2 cut(s) 9, 86
CviJI RGCY 6 cut(s) 32, 84, 124, 129, 137, 164
CviKI_1 RGCY 6 cut(s) 32, 84, 124, 129, 137, 164
EaeI YGGCCR 1 cut(s) 122
Eco130I CCWWGG 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 37
ErhI CCWWGG 1 cut(s) 37
FaeI CATG 2 cut(s) 12, 89
FaiI YATR 5 cut(s) 10, 15, 87, 105, 184
FatI CATG 2 cut(s) 8, 85
FokI GGATG 1 cut(s) 158
FspBI CTAG 2 cut(s) 38, 224
HaeIII GGCC 2 cut(s) 84, 124
Hin1II CATG 2 cut(s) 12, 89
HindIII AAGCTT 1 cut(s) 162
HphI GGTGA 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 55
Hpy8I GTNNAC 1 cut(s) 97
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 1 cut(s) 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
Hsp92II CATG 2 cut(s) 12, 89
LmnI GCTCC 2 cut(s) 37, 142
LpnPI CCDG 1 cut(s) 63
MaeI CTAG 2 cut(s) 38, 224
MaeIII GTNAC 2 cut(s) 167, 203
MfeI CAATTG 1 cut(s) 238
MlsI TGGCCA 1 cut(s) 124
MluCI AATT 3 cut(s) 42, 229, 238
MluNI TGGCCA 1 cut(s) 124
Mox20I TGGCCA 1 cut(s) 124
MscI TGGCCA 1 cut(s) 124
Msp20I TGGCCA 1 cut(s) 124
MunI CAATTG 1 cut(s) 238
MvnI CGCG 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 121
NlaIII CATG 2 cut(s) 12, 89
NlaIV GGNNCC 1 cut(s) 138
NmuCI GTSAC 1 cut(s) 167
NruI TCGCGA 1 cut(s) 56
PflMI CCANNNNNTGG 1 cut(s) 146
PspN4I GGNNCC 1 cut(s) 138
PspPI GGNCC 1 cut(s) 82
RruI TCGCGA 1 cut(s) 56
Sau96I GGNCC 1 cut(s) 82
SetI ASST 4 cut(s) 34, 131, 166, 225
Sse9I AATT 3 cut(s) 42, 229, 238
SspMI CTAG 2 cut(s) 38, 224
StyI CCWWGG 1 cut(s) 37
TaaI ACNGT 1 cut(s) 176
TasI AATT 3 cut(s) 42, 229, 238
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
Van91I CCANNNNNTGG 1 cut(s) 146
XmaJI CCTAGG 1 cut(s) 37
XspI CTAG 2 cut(s) 38, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.