Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8127886.1

Orthogroup ID

OG0019868

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 442

Gene Structure 442 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8127886.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 230 bp

atgttccttatgtctaagcagacatactttgatagccctgctggcacagatccagtggctctaaatttaggaagcatgggaaagggccaggcttgggtcaatggccaccatataggaaggtattggacacttgttgctccaaaagatggatgccaagaaatctgtgattatcgaggggcatacaactccgataagtgcacaacaaattgtgggaagcctactcaaacctg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004553 GO:0004565 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0009505 GO:0015925 GO:0016020 GO:0016787 GO:0016798 GO:0030312 GO:0031090 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0071944 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Gal_Lectin Glyco_hydro_35

Protein Analysis

76

Amino Acids

8.33

Weight (kDa)

7.67

Isoelectric Point (pI)

31.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019868)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0095601 RchiOBHm_Chr2g0095621
rosa_multiflora	Rmu_co8127886.1_g000001 Rmu_sc0003026.1_g000002
rosa_roxburghii	Rroxscaffold_2G00146160
rosa_samantha	Rh2AG100500 Rh2DG101600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	146
AclWI	GGATC	1 cut(s)	44
AcoI	YGGCCR	1 cut(s)	103
AcsI	RAATTY	1 cut(s)	64
AfiI	CCNNNNNNNGG	2 cut(s)	94, 146
AjnI	CCWGG	1 cut(s)	87
Alw21I	GWGCWC	1 cut(s)	200
Alw44I	GTGCAC	1 cut(s)	196
AlwI	GGATC	1 cut(s)	44
AoxI	GGCC	2 cut(s)	85, 103
ApaLI	GTGCAC	1 cut(s)	196
ApoI	RAATTY	1 cut(s)	64
AspS9I	GGNCC	1 cut(s)	85
BaeGI	GKGCMC	1 cut(s)	200
BalI	TGGCCA	1 cut(s)	105
Bbv12I	GWGCWC	1 cut(s)	200
BccI	CCATC	1 cut(s)	140
BciT130I	CCWGG	1 cut(s)	89
BglI	GCCNNNNNGGC	1 cut(s)	42
Bme1390I	CCNGG	1 cut(s)	89
BmgT120I	GGNCC	1 cut(s)	85
BmrFI	CCNGG	1 cut(s)	89
BmsI	GCATC	1 cut(s)	140
Bsc4I	CCNNNNNNNGG	2 cut(s)	94, 146
Bse1I	ACTGG	1 cut(s)	53
BseBI	CCWGG	1 cut(s)	89
BseGI	GGATG	1 cut(s)	155
BseLI	CCNNNNNNNGG	2 cut(s)	94, 146
BseNI	ACTGG	1 cut(s)	53
BseSI	GKGCMC	1 cut(s)	200
BshFI	GGCC	2 cut(s)	87, 105
BsiHKAI	GWGCWC	1 cut(s)	200
BslI	CCNNNNNNNGG	2 cut(s)	94, 146
BsnI	GGCC	2 cut(s)	87, 105
Bsp1286I	GDGCHC	1 cut(s)	200
Bsp143I	GATC	1 cut(s)	49
BspANI	GGCC	2 cut(s)	87, 105
BspPI	GGATC	1 cut(s)	44
BsrI	ACTGG	1 cut(s)	53
BssMI	GATC	1 cut(s)	49
Bst2UI	CCWGG	1 cut(s)	89
BstC8I	GCNNGC	1 cut(s)	43
BstDEI	CTNAG	1 cut(s)	15
BstF5I	GGATG	1 cut(s)	155
BstKTI	GATC	1 cut(s)	52
BstMBI	GATC	1 cut(s)	49
BstMWI	GCNNNNNNNGC	1 cut(s)	42
BstNI	CCWGG	1 cut(s)	89
BstSCI	CCNGG	1 cut(s)	87
BstSLI	GKGCMC	1 cut(s)	200
BstX2I	RGATCY	1 cut(s)	49
BstYI	RGATCY	1 cut(s)	49
BsuRI	GGCC	2 cut(s)	87, 105
BtsCI	GGATG	1 cut(s)	155
BtsIMutI	CAGTG	1 cut(s)	60
Cac8I	GCNNGC	1 cut(s)	43
Cfr13I	GGNCC	1 cut(s)	85
CviAII	CATG	1 cut(s)	76
CviJI	RGCY	6 cut(s)	36, 59, 87, 92, 105, 217
CviKI_1	RGCY	6 cut(s)	36, 59, 87, 92, 105, 217
DdeI	CTNAG	1 cut(s)	15
DpnI	GATC	1 cut(s)	51
DpnII	GATC	1 cut(s)	49
EaeI	YGGCCR	1 cut(s)	103
EcoRII	CCWGG	1 cut(s)	87
FaeI	CATG	1 cut(s)	79
FaiI	YATR	6 cut(s)	11, 25, 77, 111, 113, 181
FatI	CATG	1 cut(s)	75
FokI	GGATG	1 cut(s)	162
HaeIII	GGCC	2 cut(s)	87, 105
Hin1II	CATG	1 cut(s)	79
Hpy166II	GTNNAC	1 cut(s)	198
Hpy188I	TCNGA	1 cut(s)	190
Hpy8I	GTNNAC	1 cut(s)	198
HpyAV	CCTTC	1 cut(s)	111
HpyCH4V	TGCA	1 cut(s)	198
HpyF10VI	GCNNNNNNNGC	1 cut(s)	42
HpyF3I	CTNAG	1 cut(s)	15
Hsp92II	CATG	1 cut(s)	79
Kzo9I	GATC	1 cut(s)	49
LmnI	GCTCC	1 cut(s)	142
LpnPI	CCDG	5 cut(s)	27, 51, 66, 74, 101
LweI	GCATC	1 cut(s)	140
MalI	GATC	1 cut(s)	51
MboI	GATC	1 cut(s)	49
MflI	RGATCY	1 cut(s)	49
MhlI	GDGCHC	1 cut(s)	200
MlsI	TGGCCA	1 cut(s)	105
MluCI	AATT	2 cut(s)	64, 205
MluNI	TGGCCA	1 cut(s)	105
MnlI	CCTC	1 cut(s)	167
Mox20I	TGGCCA	1 cut(s)	105
MscI	TGGCCA	1 cut(s)	105
Msp20I	TGGCCA	1 cut(s)	105
MspR9I	CCNGG	1 cut(s)	89
MvaI	CCWGG	1 cut(s)	89
MwoI	GCNNNNNNNGC	1 cut(s)	42
NdeII	GATC	1 cut(s)	49
NlaIII	CATG	1 cut(s)	79
PflMI	CCANNNNNTGG	1 cut(s)	146
Psp6I	CCWGG	1 cut(s)	87
PspGI	CCWGG	1 cut(s)	87
PspPI	GGNCC	1 cut(s)	85
PsuI	RGATCY	1 cut(s)	49
Sau3AI	GATC	1 cut(s)	49
Sau96I	GGNCC	1 cut(s)	85
ScrFI	CCNGG	1 cut(s)	89
SduI	GDGCHC	1 cut(s)	200
SetI	ASST	2 cut(s)	122, 230
SfaNI	GCATC	1 cut(s)	140
Sse9I	AATT	2 cut(s)	64, 205
StyD4I	CCNGG	1 cut(s)	87
TaqI	TCGA	1 cut(s)	172
TasI	AATT	2 cut(s)	64, 205
TscAI	CASTG	1 cut(s)	60
TspRI	CASTG	1 cut(s)	60
Van91I	CCANNNNNTGG	1 cut(s)	146
VneI	GTGCAC	1 cut(s)	196
XapI	RAATTY	1 cut(s)	64

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.