RchiOBHm_Chr2g0111991

AT-hook motif nuclear-localized protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
23738363 .. 23740335
1973 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48552

Sequence Viewer

Length: 255 bp
ATGAAGGGCTACAATGGATTAAAACCCTTCATGATGACTACTTCTTTCCACAAAGACAATTCAAATTCTCTGAGCCACCTGATGCATCAGAACTTTAAAAATTCAACTTTTGAGAGTAACTCATTGGTAGCAGAAGAAGAGTACTTCAAAGGCTCTGGCCAATCAAATTGTGAAGTTTCTTTTGATCATGATTCCACGGTCTCCTTGTGTGATAGTTGTACCCGAATGGTTTTCTTCAGACTTGGTGACATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.54

Weight (kDa)

5.69

Isoelectric Point (pI)

41.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017759)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 157
AcsI RAATTY 2 cut(s) 64, 100
AcuI CTGAAG 1 cut(s) 220
AfaI GTAC 2 cut(s) 143, 220
AgsI TTSAA 3 cut(s) 63, 105, 148
Alw26I GTCTC 1 cut(s) 205
AoxI GGCC 1 cut(s) 157
ApoI RAATTY 2 cut(s) 64, 100
BalI TGGCCA 1 cut(s) 159
BclI TGATCA 1 cut(s) 184
BcoDI GTCTC 1 cut(s) 205
BfaI CTAG 1 cut(s) 253
BmcAI AGTACT 1 cut(s) 143
BmsI GCATC 2 cut(s) 72, 94
BplI GAGNNNNNCTC 2 cut(s) 104, 136
BsaI GGTCTC 1 cut(s) 205
BsaJI CCNNGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 195
BseMII CTCAG 1 cut(s) 62
BshFI GGCC 1 cut(s) 159
BsmAI GTCTC 1 cut(s) 205
BsnI GGCC 1 cut(s) 159
Bso31I GGTCTC 1 cut(s) 205
Bsp143I GATC 1 cut(s) 184
BspANI GGCC 1 cut(s) 159
BspCNI CTCAG 1 cut(s) 63
BspHI TCATGA 2 cut(s) 30, 187
BspTNI GGTCTC 1 cut(s) 205
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 1 cut(s) 184
Bst4CI ACNGT 1 cut(s) 199
Bst6I CTCTTC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 71
BstDSI CCRYGG 1 cut(s) 195
BstKTI GATC 1 cut(s) 187
BstMAI GTCTC 1 cut(s) 205
BstMBI GATC 1 cut(s) 184
BsuRI GGCC 1 cut(s) 159
BtgI CCRYGG 1 cut(s) 195
CciI TCATGA 2 cut(s) 30, 187
Csp6I GTAC 2 cut(s) 142, 219
CviAII CATG 2 cut(s) 31, 188
CviJI RGCY 4 cut(s) 9, 75, 153, 159
CviKI_1 RGCY 4 cut(s) 9, 75, 153, 159
CviQI GTAC 2 cut(s) 142, 219
DdeI CTNAG 1 cut(s) 71
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
DraI TTTAAA 1 cut(s) 97
EaeI YGGCCR 1 cut(s) 157
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
Eco31I GGTCTC 1 cut(s) 205
Eco57I CTGAAG 1 cut(s) 220
EcoT22I ATGCAT 1 cut(s) 87
FaeI CATG 2 cut(s) 34, 191
FaiI YATR 2 cut(s) 32, 189
FatI CATG 2 cut(s) 30, 187
FbaI TGATCA 1 cut(s) 184
FspBI CTAG 1 cut(s) 253
HaeIII GGCC 1 cut(s) 159
Hin1II CATG 2 cut(s) 34, 191
HinfI GANTC 1 cut(s) 191
Hpy188I TCNGA 3 cut(s) 72, 90, 239
Hpy188III TCNNGA 2 cut(s) 31, 188
HpyAV CCTTC 1 cut(s) 37
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4V TGCA 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 71
Hsp92II CATG 2 cut(s) 34, 191
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 2 cut(s) 92, 141
LweI GCATC 2 cut(s) 72, 94
MaeI CTAG 1 cut(s) 253
MaeIII GTNAC 2 cut(s) 116, 245
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 3 cut(s) 146, 149, 226
MlsI TGGCCA 1 cut(s) 159
MluCI AATT 4 cut(s) 58, 64, 100, 166
MluNI TGGCCA 1 cut(s) 159
Mox20I TGGCCA 1 cut(s) 159
Mph1103I ATGCAT 1 cut(s) 87
MscI TGGCCA 1 cut(s) 159
MseI TTAA 2 cut(s) 20, 96
Msp20I TGGCCA 1 cut(s) 159
NdeII GATC 1 cut(s) 184
NlaIII CATG 2 cut(s) 34, 191
NmuCI GTSAC 1 cut(s) 245
NsiI ATGCAT 1 cut(s) 87
PagI TCATGA 2 cut(s) 30, 187
PfeI GAWTC 1 cut(s) 191
RsaI GTAC 2 cut(s) 143, 220
RsaNI GTAC 2 cut(s) 142, 219
SaqAI TTAA 2 cut(s) 20, 96
Sau3AI GATC 1 cut(s) 184
ScaI AGTACT 1 cut(s) 143
SetI ASST 1 cut(s) 81
SfaNI GCATC 2 cut(s) 72, 94
SgeI CNNG 7 cut(s) 43, 91, 168, 200, 208, 217, 234
Sse9I AATT 4 cut(s) 58, 64, 100, 166
SspMI CTAG 1 cut(s) 253
TaaI ACNGT 1 cut(s) 199
TasI AATT 4 cut(s) 58, 64, 100, 166
TatI WGTACW 1 cut(s) 141
TfiI GAWTC 1 cut(s) 191
Tru1I TTAA 2 cut(s) 20, 96
Tru9I TTAA 2 cut(s) 20, 96
TseFI GTSAC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 245
TspDTI ATGAA 2 cut(s) 17, 19
XapI RAATTY 2 cut(s) 64, 100
XspI CTAG 1 cut(s) 253
ZrmI AGTACT 1 cut(s) 143
Zsp2I ATGCAT 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.