Rw3G020720

AT-hook motif nuclear-localized protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Forward (+)
24645198 .. 24645500
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G020720.1

Sequence Viewer

Length: 303 bp
ATGGTGGGAAGTTTTCTACCAGGTCACCAGCAGGAACACAAGCCTAAGAAGCAGAGAATCAAGTCAGTGTCATCACCGATTGTCCCTATCATTGTCAACTCTGTGATTGGTGAAGAAATGAAGGGCTACAGTGGATTAAAACCCTTCACGATGACTACTTCCTTCCACAGAGACAATTCAAATTCTCTGAGCCACTTGATGCATCAGAACTTTAAAAATTCAACTTTTGAGAGTAACTCATTGGTAGCAGAAGAAGAGTACTCCAAAGGCTCTGGCCAATCAAACTGTGAAGTTTCTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.09

Weight (kDa)

7.84

Isoelectric Point (pI)

43.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017759)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 274
AcsI RAATTY 2 cut(s) 181, 217
AfaI GTAC 1 cut(s) 260
AgsI TTSAA 2 cut(s) 180, 222
AjnI CCWGG 1 cut(s) 19
Alw26I GTCTC 1 cut(s) 165
AoxI GGCC 1 cut(s) 274
ApoI RAATTY 2 cut(s) 181, 217
AsuHPI GGTGA 3 cut(s) 17, 66, 122
BalI TGGCCA 1 cut(s) 276
BciT130I CCWGG 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 165
BfmI CTRYAG 1 cut(s) 127
BmcAI AGTACT 1 cut(s) 260
Bme1390I CCNGG 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 2 cut(s) 189, 211
BplI GAGNNNNNCTC 2 cut(s) 221, 253
BseBI CCWGG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 179
BshFI GGCC 1 cut(s) 276
BslFI GGGAC 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 165
BsmFI GGGAC 1 cut(s) 68
BsnI GGCC 1 cut(s) 276
BspANI GGCC 1 cut(s) 276
BspCNI CTCAG 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 21
Bst4CI ACNGT 2 cut(s) 131, 287
Bst6I CTCTTC 1 cut(s) 249
BstDEI CTNAG 2 cut(s) 45, 188
BstEII GGTNACC 1 cut(s) 23
BstMAI GTCTC 1 cut(s) 165
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstNI CCWGG 1 cut(s) 21
BstPI GGTNACC 1 cut(s) 23
BstSCI CCNGG 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 127
BsuRI GGCC 1 cut(s) 276
BtsIMutI CAGTG 2 cut(s) 72, 136
CsiI ACCWGGT 1 cut(s) 19
Csp6I GTAC 1 cut(s) 259
CviJI RGCY 5 cut(s) 43, 126, 192, 270, 276
CviKI_1 RGCY 5 cut(s) 43, 126, 192, 270, 276
CviQI GTAC 1 cut(s) 259
DdeI CTNAG 2 cut(s) 45, 188
DraI TTTAAA 1 cut(s) 214
EaeI YGGCCR 1 cut(s) 274
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
Eco91I GGTNACC 1 cut(s) 23
EcoO65I GGTNACC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 19
EcoT22I ATGCAT 1 cut(s) 204
FaqI GGGAC 1 cut(s) 68
HaeIII GGCC 1 cut(s) 276
HincII GTYRAC 1 cut(s) 97
HindII GTYRAC 1 cut(s) 97
HinfI GANTC 1 cut(s) 57
HphI GGTGA 3 cut(s) 17, 66, 122
Hpy166II GTNNAC 1 cut(s) 97
Hpy188I TCNGA 2 cut(s) 189, 207
Hpy188III TCNNGA 1 cut(s) 148
Hpy8I GTNNAC 1 cut(s) 97
HpyAV CCTTC 3 cut(s) 115, 154, 172
HpyCH4III ACNGT 2 cut(s) 131, 287
HpyCH4V TGCA 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 2 cut(s) 45, 188
LpnPI CCDG 5 cut(s) 6, 17, 33, 41, 258
LweI GCATC 2 cut(s) 189, 211
MabI ACCWGGT 1 cut(s) 19
MaeIII GTNAC 2 cut(s) 23, 233
MboII GAAGA 3 cut(s) 125, 263, 266
MlsI TGGCCA 1 cut(s) 276
MluCI AATT 3 cut(s) 175, 181, 217
MluNI TGGCCA 1 cut(s) 276
Mox20I TGGCCA 1 cut(s) 276
Mph1103I ATGCAT 1 cut(s) 204
MscI TGGCCA 1 cut(s) 276
MseI TTAA 2 cut(s) 137, 213
Msp20I TGGCCA 1 cut(s) 276
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 49
NmuCI GTSAC 1 cut(s) 23
NsiI ATGCAT 1 cut(s) 204
PfeI GAWTC 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 19
PspEI GGTNACC 1 cut(s) 23
PspGI CCWGG 1 cut(s) 19
RsaI GTAC 1 cut(s) 260
RsaNI GTAC 1 cut(s) 259
SaqAI TTAA 2 cut(s) 137, 213
ScaI AGTACT 1 cut(s) 260
ScrFI CCNGG 1 cut(s) 21
SetI ASST 1 cut(s) 25
SexAI ACCWGGT 1 cut(s) 19
SfaNI GCATC 2 cut(s) 189, 211
SfcI CTRYAG 1 cut(s) 127
SgeI CNNG 9 cut(s) 32, 33, 40, 44, 52, 73, 160, 208, 285
Sse9I AATT 3 cut(s) 175, 181, 217
StyD4I CCNGG 1 cut(s) 19
TaaI ACNGT 2 cut(s) 131, 287
TasI AATT 3 cut(s) 175, 181, 217
TatI WGTACW 1 cut(s) 258
TfiI GAWTC 1 cut(s) 57
Tru1I TTAA 2 cut(s) 137, 213
Tru9I TTAA 2 cut(s) 137, 213
TscAI CASTG 2 cut(s) 72, 136
TseFI GTSAC 1 cut(s) 23
Tsp45I GTSAC 1 cut(s) 23
TspDTI ATGAA 1 cut(s) 134
TspRI CASTG 2 cut(s) 72, 136
XapI RAATTY 2 cut(s) 181, 217
ZrmI AGTACT 1 cut(s) 260
Zsp2I ATGCAT 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.