Rh3DG145800

AT-hook motif nuclear-localized protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
12461948 .. 12462319
372 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG145800.1

Sequence Viewer

Length: 372 bp
ATGGTGGGAAGTTTTCTACCAGGTCACCAGCAGGAACACAAGCCTAAGAAGCAGAGAATCAAGTCAGTGTCATCACCGATTGTCCCTATCATTGTCAAATCTGTGATTGGTGAAGAAATGAAGGGCTACAGTGGATTAAAACCATTCATGATGACTACTTCCTTCCACAGAGACAATTCAAATTCTCTGAGCCACCTGATGCATCAGAACTTTAAAAATTCAACTTTTGAGAGTAACTCATTGGTAGCAGAAGAAGAGTACTTCAAAGGCTCTGGCCAATCAAATTGTGAAGTTTCTTTTGATCATGATTCCACGATCTCCTTGTGTGATAGTTGTACCCGAATGGTTTTCTTCATACTTGGTGACATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.81

Weight (kDa)

6.58

Isoelectric Point (pI)

45.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017759)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 274
AcsI RAATTY 2 cut(s) 181, 217
AfaI GTAC 2 cut(s) 260, 337
AgsI TTSAA 3 cut(s) 180, 222, 265
AjnI CCWGG 1 cut(s) 19
Alw26I GTCTC 1 cut(s) 165
AoxI GGCC 1 cut(s) 274
ApoI RAATTY 2 cut(s) 181, 217
AsuHPI GGTGA 3 cut(s) 17, 66, 122
BalI TGGCCA 1 cut(s) 276
BciT130I CCWGG 1 cut(s) 21
BclI TGATCA 1 cut(s) 301
BcoDI GTCTC 1 cut(s) 165
BfaI CTAG 1 cut(s) 370
BfmI CTRYAG 1 cut(s) 127
BmcAI AGTACT 1 cut(s) 260
Bme1390I CCNGG 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 2 cut(s) 189, 211
BplI GAGNNNNNCTC 2 cut(s) 221, 253
BseBI CCWGG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 179
BshFI GGCC 1 cut(s) 276
BslFI GGGAC 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 165
BsmFI GGGAC 1 cut(s) 68
BsnI GGCC 1 cut(s) 276
Bsp143I GATC 2 cut(s) 301, 315
BspANI GGCC 1 cut(s) 276
BspCNI CTCAG 1 cut(s) 180
BspHI TCATGA 2 cut(s) 147, 304
BssMI GATC 2 cut(s) 301, 315
Bst2UI CCWGG 1 cut(s) 21
Bst4CI ACNGT 1 cut(s) 131
Bst6I CTCTTC 1 cut(s) 249
BstDEI CTNAG 2 cut(s) 45, 188
BstEII GGTNACC 1 cut(s) 23
BstKTI GATC 2 cut(s) 304, 318
BstMAI GTCTC 1 cut(s) 165
BstMBI GATC 2 cut(s) 301, 315
BstMWI GCNNNNNNNGC 1 cut(s) 49
BstNI CCWGG 1 cut(s) 21
BstPI GGTNACC 1 cut(s) 23
BstSCI CCNGG 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 127
BsuRI GGCC 1 cut(s) 276
BtsIMutI CAGTG 2 cut(s) 72, 136
CciI TCATGA 2 cut(s) 147, 304
CsiI ACCWGGT 1 cut(s) 19
Csp6I GTAC 2 cut(s) 259, 336
CviAII CATG 2 cut(s) 148, 305
CviJI RGCY 5 cut(s) 43, 126, 192, 270, 276
CviKI_1 RGCY 5 cut(s) 43, 126, 192, 270, 276
CviQI GTAC 2 cut(s) 259, 336
DdeI CTNAG 2 cut(s) 45, 188
DpnI GATC 2 cut(s) 303, 317
DpnII GATC 2 cut(s) 301, 315
DraI TTTAAA 1 cut(s) 214
EaeI YGGCCR 1 cut(s) 274
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
Eco91I GGTNACC 1 cut(s) 23
EcoO65I GGTNACC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 19
EcoT22I ATGCAT 1 cut(s) 204
FaeI CATG 2 cut(s) 151, 308
FaiI YATR 3 cut(s) 149, 306, 356
FaqI GGGAC 1 cut(s) 68
FatI CATG 2 cut(s) 147, 304
FbaI TGATCA 1 cut(s) 301
FspBI CTAG 1 cut(s) 370
HaeIII GGCC 1 cut(s) 276
Hin1II CATG 2 cut(s) 151, 308
HinfI GANTC 2 cut(s) 57, 308
HphI GGTGA 3 cut(s) 17, 66, 122
Hpy188I TCNGA 2 cut(s) 189, 207
Hpy188III TCNNGA 2 cut(s) 148, 305
HpyAV CCTTC 2 cut(s) 115, 172
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 1 cut(s) 49
HpyF3I CTNAG 2 cut(s) 45, 188
Hsp92II CATG 2 cut(s) 151, 308
Ksp22I TGATCA 1 cut(s) 301
Kzo9I GATC 2 cut(s) 301, 315
LpnPI CCDG 6 cut(s) 6, 17, 33, 41, 209, 258
LweI GCATC 2 cut(s) 189, 211
MabI ACCWGGT 1 cut(s) 19
MaeI CTAG 1 cut(s) 370
MaeIII GTNAC 3 cut(s) 23, 233, 362
MalI GATC 2 cut(s) 303, 317
MboI GATC 2 cut(s) 301, 315
MboII GAAGA 4 cut(s) 125, 263, 266, 343
MlsI TGGCCA 1 cut(s) 276
MluCI AATT 4 cut(s) 175, 181, 217, 283
MluNI TGGCCA 1 cut(s) 276
Mox20I TGGCCA 1 cut(s) 276
Mph1103I ATGCAT 1 cut(s) 204
MscI TGGCCA 1 cut(s) 276
MseI TTAA 2 cut(s) 137, 213
Msp20I TGGCCA 1 cut(s) 276
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 49
NdeII GATC 2 cut(s) 301, 315
NlaIII CATG 2 cut(s) 151, 308
NmuCI GTSAC 2 cut(s) 23, 362
NsiI ATGCAT 1 cut(s) 204
PagI TCATGA 2 cut(s) 147, 304
PfeI GAWTC 2 cut(s) 57, 308
Psp6I CCWGG 1 cut(s) 19
PspEI GGTNACC 1 cut(s) 23
PspGI CCWGG 1 cut(s) 19
RsaI GTAC 2 cut(s) 260, 337
RsaNI GTAC 2 cut(s) 259, 336
SaqAI TTAA 2 cut(s) 137, 213
Sau3AI GATC 2 cut(s) 301, 315
ScaI AGTACT 1 cut(s) 260
ScrFI CCNGG 1 cut(s) 21
SetI ASST 2 cut(s) 25, 198
SexAI ACCWGGT 1 cut(s) 19
SfaNI GCATC 2 cut(s) 189, 211
SfcI CTRYAG 1 cut(s) 127
Sse9I AATT 4 cut(s) 175, 181, 217, 283
SspMI CTAG 1 cut(s) 370
StyD4I CCNGG 1 cut(s) 19
TaaI ACNGT 1 cut(s) 131
TasI AATT 4 cut(s) 175, 181, 217, 283
TatI WGTACW 1 cut(s) 258
TfiI GAWTC 2 cut(s) 57, 308
Tru1I TTAA 2 cut(s) 137, 213
Tru9I TTAA 2 cut(s) 137, 213
TscAI CASTG 2 cut(s) 72, 136
TseFI GTSAC 2 cut(s) 23, 362
Tsp45I GTSAC 2 cut(s) 23, 362
TspDTI ATGAA 3 cut(s) 134, 136, 343
TspRI CASTG 2 cut(s) 72, 136
XapI RAATTY 2 cut(s) 181, 217
XspI CTAG 1 cut(s) 370
ZrmI AGTACT 1 cut(s) 260
Zsp2I ATGCAT 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.