Rw6G014630

AT-hook motif nuclear-localized protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0017759
Physical Location & Seq
Forward (+)
27136566 .. 27137394
829 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G014630.1

Sequence Viewer

Length: 387 bp
ATGATAAATCAGGTTATGGTGGGAAGTTTTCTACCAGGTCACCAGCAGGAACACAAGCCTAAGAAGCAGAGAATCAAGTTAGTGTCATCACCCATTGTCCCTATCATTGTCAACTCTGTGATTGGTGAAGAAATGAAGGGCTACAGTGGATTAAAACCCTTCATGATGACTACTTCCTTCCACAGAGACAATTCAAATTCTCTGAGCCACCTGATGCATCAGAACTTTAAAAATTCAACTTTTGAGAGTAACTCATTGGTAGCAGAAGAAGAGTACTTCAAAGGCTCTGGCCAATCAAATTGTGAAGTTTCTTTTGATCATGATTCCACGGTCTCCTTGTGTGATAGTTGTACCCGAATGGTTTTCTTCAGACTTGGTGACATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF296

Protein Analysis

128

Amino Acids

14.43

Weight (kDa)

6.58

Isoelectric Point (pI)

40.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017759)

Species Orthologous Gene IDs
pyrus_communis pycom01g19740
rosa_chinensis RchiOBHm_Chr2g0111991
rosa_roxburghii Rroxscaffold_5G00349060
rosa_samantha Rh3BG144600 Rh3CG146000 Rh3DG145800 Rh5AG181200 Rh6AG351100 Rh7BG241500
rosa_wichuraiana Rw3G020720 Rw5G016440 Rw6G014630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 289
AcsI RAATTY 2 cut(s) 196, 232
AcuI CTGAAG 1 cut(s) 352
AfaI GTAC 2 cut(s) 275, 352
AgsI TTSAA 3 cut(s) 195, 237, 280
AjnI CCWGG 1 cut(s) 34
Alw26I GTCTC 2 cut(s) 180, 337
AoxI GGCC 1 cut(s) 289
ApoI RAATTY 2 cut(s) 196, 232
AsuHPI GGTGA 3 cut(s) 32, 81, 137
BalI TGGCCA 1 cut(s) 291
BciT130I CCWGG 1 cut(s) 36
BclI TGATCA 1 cut(s) 316
BcoDI GTCTC 2 cut(s) 180, 337
BfaI CTAG 1 cut(s) 385
BfmI CTRYAG 1 cut(s) 142
BmcAI AGTACT 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 36
BmrFI CCNGG 1 cut(s) 36
BmsI GCATC 2 cut(s) 204, 226
BplI GAGNNNNNCTC 2 cut(s) 236, 268
BsaI GGTCTC 1 cut(s) 337
BsaJI CCNNGG 1 cut(s) 327
BseBI CCWGG 1 cut(s) 36
BseDI CCNNGG 1 cut(s) 327
BseMII CTCAG 1 cut(s) 194
BshFI GGCC 1 cut(s) 291
BslFI GGGAC 1 cut(s) 83
BsmAI GTCTC 2 cut(s) 180, 337
BsmFI GGGAC 1 cut(s) 83
BsnI GGCC 1 cut(s) 291
Bso31I GGTCTC 1 cut(s) 337
Bsp143I GATC 1 cut(s) 316
BspANI GGCC 1 cut(s) 291
BspCNI CTCAG 1 cut(s) 195
BspHI TCATGA 2 cut(s) 162, 319
BspTNI GGTCTC 1 cut(s) 337
BssECI CCNNGG 1 cut(s) 327
BssMI GATC 1 cut(s) 316
Bst2UI CCWGG 1 cut(s) 36
Bst4CI ACNGT 2 cut(s) 146, 331
Bst6I CTCTTC 1 cut(s) 264
BstDEI CTNAG 2 cut(s) 60, 203
BstDSI CCRYGG 1 cut(s) 327
BstEII GGTNACC 1 cut(s) 38
BstKTI GATC 1 cut(s) 319
BstMAI GTCTC 2 cut(s) 180, 337
BstMBI GATC 1 cut(s) 316
BstMWI GCNNNNNNNGC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 36
BstPI GGTNACC 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 34
BstSFI CTRYAG 1 cut(s) 142
BsuRI GGCC 1 cut(s) 291
BtgI CCRYGG 1 cut(s) 327
BtsIMutI CAGTG 1 cut(s) 151
CciI TCATGA 2 cut(s) 162, 319
CsiI ACCWGGT 1 cut(s) 34
Csp6I GTAC 2 cut(s) 274, 351
CviAII CATG 2 cut(s) 163, 320
CviJI RGCY 5 cut(s) 58, 141, 207, 285, 291
CviKI_1 RGCY 5 cut(s) 58, 141, 207, 285, 291
CviQI GTAC 2 cut(s) 274, 351
DdeI CTNAG 2 cut(s) 60, 203
DpnI GATC 1 cut(s) 318
DpnII GATC 1 cut(s) 316
DraI TTTAAA 1 cut(s) 229
EaeI YGGCCR 1 cut(s) 289
Eam1104I CTCTTC 1 cut(s) 264
EarI CTCTTC 1 cut(s) 264
Eco31I GGTCTC 1 cut(s) 337
Eco57I CTGAAG 1 cut(s) 352
Eco91I GGTNACC 1 cut(s) 38
EcoO65I GGTNACC 1 cut(s) 38
EcoRII CCWGG 1 cut(s) 34
EcoT22I ATGCAT 1 cut(s) 219
FaeI CATG 2 cut(s) 166, 323
FaiI YATR 3 cut(s) 17, 164, 321
FaqI GGGAC 1 cut(s) 83
FatI CATG 2 cut(s) 162, 319
FbaI TGATCA 1 cut(s) 316
FspBI CTAG 1 cut(s) 385
HaeIII GGCC 1 cut(s) 291
Hin1II CATG 2 cut(s) 166, 323
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HinfI GANTC 2 cut(s) 72, 323
HphI GGTGA 3 cut(s) 32, 81, 137
Hpy166II GTNNAC 1 cut(s) 112
Hpy188I TCNGA 3 cut(s) 204, 222, 371
Hpy188III TCNNGA 2 cut(s) 163, 320
Hpy8I GTNNAC 1 cut(s) 112
HpyAV CCTTC 3 cut(s) 130, 169, 187
HpyCH4III ACNGT 2 cut(s) 146, 331
HpyCH4V TGCA 1 cut(s) 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 64
HpyF3I CTNAG 2 cut(s) 60, 203
Hsp92II CATG 2 cut(s) 166, 323
Ksp22I TGATCA 1 cut(s) 316
Kzo9I GATC 1 cut(s) 316
LpnPI CCDG 6 cut(s) 21, 32, 48, 56, 224, 273
LweI GCATC 2 cut(s) 204, 226
MabI ACCWGGT 1 cut(s) 34
MaeI CTAG 1 cut(s) 385
MaeIII GTNAC 3 cut(s) 38, 248, 377
MalI GATC 1 cut(s) 318
MboI GATC 1 cut(s) 316
MboII GAAGA 4 cut(s) 140, 278, 281, 358
MlsI TGGCCA 1 cut(s) 291
MluCI AATT 4 cut(s) 190, 196, 232, 298
MluNI TGGCCA 1 cut(s) 291
Mox20I TGGCCA 1 cut(s) 291
Mph1103I ATGCAT 1 cut(s) 219
MscI TGGCCA 1 cut(s) 291
MseI TTAA 2 cut(s) 152, 228
Msp20I TGGCCA 1 cut(s) 291
MspR9I CCNGG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 64
NdeII GATC 1 cut(s) 316
NlaIII CATG 2 cut(s) 166, 323
NmuCI GTSAC 2 cut(s) 38, 377
NsiI ATGCAT 1 cut(s) 219
PagI TCATGA 2 cut(s) 162, 319
PfeI GAWTC 2 cut(s) 72, 323
Psp6I CCWGG 1 cut(s) 34
PspEI GGTNACC 1 cut(s) 38
PspGI CCWGG 1 cut(s) 34
RsaI GTAC 2 cut(s) 275, 352
RsaNI GTAC 2 cut(s) 274, 351
SaqAI TTAA 2 cut(s) 152, 228
Sau3AI GATC 1 cut(s) 316
ScaI AGTACT 1 cut(s) 275
ScrFI CCNGG 1 cut(s) 36
SetI ASST 3 cut(s) 15, 40, 213
SexAI ACCWGGT 1 cut(s) 34
SfaNI GCATC 2 cut(s) 204, 226
SfcI CTRYAG 1 cut(s) 142
Sse9I AATT 4 cut(s) 190, 196, 232, 298
SspMI CTAG 1 cut(s) 385
StyD4I CCNGG 1 cut(s) 34
TaaI ACNGT 2 cut(s) 146, 331
TasI AATT 4 cut(s) 190, 196, 232, 298
TatI WGTACW 1 cut(s) 273
TfiI GAWTC 2 cut(s) 72, 323
Tru1I TTAA 2 cut(s) 152, 228
Tru9I TTAA 2 cut(s) 152, 228
TscAI CASTG 1 cut(s) 151
TseFI GTSAC 2 cut(s) 38, 377
Tsp45I GTSAC 2 cut(s) 38, 377
TspDTI ATGAA 2 cut(s) 149, 151
TspRI CASTG 1 cut(s) 151
XapI RAATTY 2 cut(s) 196, 232
XspI CTAG 1 cut(s) 385
ZrmI AGTACT 1 cut(s) 275
Zsp2I ATGCAT 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.