Rroxscaffold_5G00349060

AT-hook motif nuclear-localized protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
21694336 .. 21696604
2269 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00349060.1

Sequence Viewer

Length: 186 bp
ATGAAGGGCTACAGTGGATTAAAACCCTTCATGATGACTACTTCCCTCCACAGAGACAATTCAAATTCTCTGAGCCACCTGATGCATCAGAACTTTAAAAATTCAACTTTTGAGAGTAACTCATTGGTAGTAGAAGAAGAGTACCCTAAAGGCTCTAGCCAATCAAACTGTGAAGTTTCTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.88

Weight (kDa)

6.24

Isoelectric Point (pI)

45.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017759)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 64, 100
AfaI GTAC 1 cut(s) 143
AgsI TTSAA 2 cut(s) 63, 105
Alw26I GTCTC 1 cut(s) 48
ApoI RAATTY 2 cut(s) 64, 100
BcoDI GTCTC 1 cut(s) 48
BfaI CTAG 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 10
BmsI GCATC 2 cut(s) 72, 94
BplI GAGNNNNNCTC 2 cut(s) 104, 136
BseMII CTCAG 1 cut(s) 62
BsmAI GTCTC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 63
BspHI TCATGA 1 cut(s) 30
Bst4CI ACNGT 2 cut(s) 14, 170
Bst6I CTCTTC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 71
BstMAI GTCTC 1 cut(s) 48
BstSFI CTRYAG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 19
CciI TCATGA 1 cut(s) 30
Csp6I GTAC 1 cut(s) 142
CviAII CATG 1 cut(s) 31
CviJI RGCY 4 cut(s) 9, 75, 153, 159
CviKI_1 RGCY 4 cut(s) 9, 75, 153, 159
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 1 cut(s) 71
DraI TTTAAA 1 cut(s) 97
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
EcoT22I ATGCAT 1 cut(s) 87
FaeI CATG 1 cut(s) 34
FaiI YATR 1 cut(s) 32
FatI CATG 1 cut(s) 30
FspBI CTAG 1 cut(s) 156
Hin1II CATG 1 cut(s) 34
Hpy188I TCNGA 2 cut(s) 72, 90
Hpy188III TCNNGA 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 37
HpyCH4III ACNGT 2 cut(s) 14, 170
HpyCH4V TGCA 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 71
Hsp92II CATG 1 cut(s) 34
LpnPI CCDG 1 cut(s) 92
LweI GCATC 2 cut(s) 72, 94
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 116
MboII GAAGA 2 cut(s) 146, 149
MluCI AATT 3 cut(s) 58, 64, 100
MnlI CCTC 1 cut(s) 56
Mph1103I ATGCAT 1 cut(s) 87
MseI TTAA 2 cut(s) 20, 96
NlaIII CATG 1 cut(s) 34
NsiI ATGCAT 1 cut(s) 87
PagI TCATGA 1 cut(s) 30
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 20, 96
SetI ASST 1 cut(s) 81
SfaNI GCATC 2 cut(s) 72, 94
SfcI CTRYAG 1 cut(s) 10
SgeI CNNG 3 cut(s) 43, 91, 168
Sse9I AATT 3 cut(s) 58, 64, 100
SspMI CTAG 1 cut(s) 156
TaaI ACNGT 2 cut(s) 14, 170
TasI AATT 3 cut(s) 58, 64, 100
Tru1I TTAA 2 cut(s) 20, 96
Tru9I TTAA 2 cut(s) 20, 96
TscAI CASTG 1 cut(s) 19
TspDTI ATGAA 2 cut(s) 17, 19
TspRI CASTG 1 cut(s) 19
XapI RAATTY 2 cut(s) 64, 100
XspI CTAG 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.