RchiOBHm_Chr2g0129411

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
45051705 .. 45052681
977 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50105

Sequence Viewer

Length: 177 bp
ATGTTTATTCGGGAAATCTTACAGGTCAGGAGAATCGAGAAGGTGATCAGGCTGCCTAGAGTAGTGGTATTTGAGTTACAGCATTATTGTGAGTTTCGTTATGTTCATTTTGAACTTAACAATTTGGAAATTGTGATAATGTGCTGTAATAAGAAATTGAGGAATTGGATATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

7.31

Weight (kDa)

9.35

Isoelectric Point (pI)

60.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 113
ApeKI GCWGC 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 55
BbvI GCAGC 1 cut(s) 39
BclI TGATCA 1 cut(s) 45
BfaI CTAG 1 cut(s) 57
BisI GCNGC 1 cut(s) 53
BlsI GCNGC 1 cut(s) 54
BseXI GCAGC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 45
BssMI GATC 1 cut(s) 45
BstKTI GATC 1 cut(s) 48
BstMBI GATC 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 39
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
FaiI YATR 1 cut(s) 102
FbaI TGATCA 1 cut(s) 45
Fnu4HI GCNGC 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 53
FspBI CTAG 1 cut(s) 57
FspEI CC 9 cut(s) 8, 13, 26, 34, 50, 69, 110, 145, 151
GluI GCNGC 1 cut(s) 53
HinfI GANTC 1 cut(s) 33
HphI GGTGA 1 cut(s) 55
Hpy188III TCNNGA 3 cut(s) 11, 28, 37
HpyAV CCTTC 1 cut(s) 34
Ksp22I TGATCA 1 cut(s) 45
Kzo9I GATC 1 cut(s) 45
LpnPI CCDG 3 cut(s) 8, 13, 34
Lsp1109I GCAGC 1 cut(s) 39
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 75
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MluCI AATT 4 cut(s) 121, 129, 155, 163
MnlI CCTC 1 cut(s) 153
MseI TTAA 1 cut(s) 117
MslI CAYNNNNRTG 1 cut(s) 87
NdeII GATC 1 cut(s) 45
PfeI GAWTC 1 cut(s) 33
PkrI GCNGC 1 cut(s) 54
RseI CAYNNNNRTG 1 cut(s) 87
SaqAI TTAA 1 cut(s) 117
SatI GCNGC 1 cut(s) 53
Sau3AI GATC 1 cut(s) 45
SetI ASST 2 cut(s) 27, 45
SgeI CNNG 6 cut(s) 23, 35, 40, 49, 61, 69
SmiMI CAYNNNNRTG 1 cut(s) 87
Sse9I AATT 4 cut(s) 121, 129, 155, 163
SspMI CTAG 1 cut(s) 57
TaqI TCGA 1 cut(s) 36
TasI AATT 4 cut(s) 121, 129, 155, 163
TfiI GAWTC 1 cut(s) 33
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TseI GCWGC 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 95
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.