RchiOBHm_Chr2g0131301

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
47418619 .. 47419108
490 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50266

Sequence Viewer

Length: 168 bp
ATGGTAGCCTGGACATTGGTAATGCGCACCAATATTTCCGCTTGGGGTTATGCAATATTGCATGTAGATATGCTAATTCGTCTACAACCCACTGCACTCCAACCTTTCTTTGTGTTACAGCTAGTGATTGAGTGCGAGTCTGATATCTCATACTTACGCATATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.43

Weight (kDa)

5.46

Isoelectric Point (pI)

63.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 26
AccI GTMKAC 1 cut(s) 82
AciI CCGC 1 cut(s) 39
AjnI CCWGG 1 cut(s) 8
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
AspLEI GCGC 1 cut(s) 27
BciT130I CCWGG 1 cut(s) 10
BfaI CTAG 1 cut(s) 122
Bme1390I CCNGG 1 cut(s) 10
BmrFI CCNGG 1 cut(s) 10
BseBI CCWGG 1 cut(s) 10
BsgI GTGCAG 1 cut(s) 78
BspACI CCGC 1 cut(s) 39
Bst2UI CCWGG 1 cut(s) 10
BstHHI GCGC 1 cut(s) 27
BstNI CCWGG 1 cut(s) 10
BstNSI RCATGY 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 8
BtsI GCAGTG 1 cut(s) 90
BtsIMutI CAGTG 1 cut(s) 90
CfoI GCGC 1 cut(s) 27
CviAII CATG 1 cut(s) 62
CviJI RGCY 2 cut(s) 8, 121
CviKI_1 RGCY 2 cut(s) 8, 121
Eco32I GATATC 1 cut(s) 145
EcoRII CCWGG 1 cut(s) 8
EcoRV GATATC 1 cut(s) 145
FaeI CATG 1 cut(s) 65
FaiI YATR 5 cut(s) 51, 63, 71, 151, 161
FatI CATG 1 cut(s) 61
FblI GTMKAC 1 cut(s) 82
FspAI RTGCGCAY 1 cut(s) 26
FspBI CTAG 1 cut(s) 122
FspI TGCGCA 1 cut(s) 26
GlaI GCGC 1 cut(s) 26
HhaI GCGC 1 cut(s) 27
Hin1II CATG 1 cut(s) 65
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 1 cut(s) 137
Hpy166II GTNNAC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 83
HpyCH4V TGCA 3 cut(s) 53, 61, 95
Hsp92II CATG 1 cut(s) 65
HspAI GCGC 1 cut(s) 25
LpnPI CCDG 1 cut(s) 22
MaeI CTAG 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 114
MluCI AATT 1 cut(s) 75
MlyI GAGTC 1 cut(s) 146
MmeI TCCRAC 1 cut(s) 124
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
NlaIII CATG 1 cut(s) 65
NsbI TGCGCA 1 cut(s) 26
NspI RCATGY 1 cut(s) 65
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
SchI GAGTC 1 cut(s) 146
ScrFI CCNGG 1 cut(s) 10
SetI ASST 2 cut(s) 106, 123
SgeI CNNG 6 cut(s) 21, 22, 54, 74, 134, 148
Sse9I AATT 1 cut(s) 75
SsiI CCGC 1 cut(s) 39
SspI AATATT 2 cut(s) 34, 57
SspMI CTAG 1 cut(s) 122
StyD4I CCNGG 1 cut(s) 8
TasI AATT 1 cut(s) 75
TscAI CASTG 1 cut(s) 97
TspRI CASTG 1 cut(s) 97
XceI RCATGY 1 cut(s) 65
XmiI GTMKAC 1 cut(s) 82
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.