RchiOBHm_Chr2g0171901

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
85451014 .. 85452804
1791 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53923

Sequence Viewer

Length: 165 bp
ATGTTTTTGTCTGAAGGCTCTATTGGAAAGGAACTTCCAGAGACAGCTATGAGGAAGTATGGAAATTGTATGGCTGATCATACATTCATTGAAGTACCTAACTGTGGAAAGCCATGGCAAGTCGAACTGAGAACATCAGCACAATTGGGTTTACTTAGAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.05

Weight (kDa)

6.53

Isoelectric Point (pI)

34.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 33
AfaI GTAC 1 cut(s) 96
AfiI CCNNNNNNNGG 1 cut(s) 104
AgsI TTSAA 1 cut(s) 92
AjuI GAANNNNNNNTTGG 1 cut(s) 38
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
Alw26I GTCTC 1 cut(s) 35
BclI TGATCA 1 cut(s) 76
BcoDI GTCTC 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 113
Bsc4I CCNNNNNNNGG 1 cut(s) 104
BseDI CCNNGG 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 104
BseMII CTCAG 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 104
BsmAI GTCTC 1 cut(s) 35
Bsp143I GATC 1 cut(s) 76
Bsp19I CCATGG 1 cut(s) 113
BspCNI CTCAG 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 113
BssMI GATC 1 cut(s) 76
BssT1I CCWWGG 1 cut(s) 113
Bst4CI ACNGT 1 cut(s) 104
BstDEI CTNAG 2 cut(s) 128, 155
BstDSI CCRYGG 1 cut(s) 113
BstKTI GATC 1 cut(s) 79
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 1 cut(s) 76
BtgI CCRYGG 1 cut(s) 113
Csp6I GTAC 1 cut(s) 95
CviAII CATG 1 cut(s) 114
CviJI RGCY 4 cut(s) 18, 47, 74, 112
CviKI_1 RGCY 4 cut(s) 18, 47, 74, 112
CviQI GTAC 1 cut(s) 95
DdeI CTNAG 2 cut(s) 128, 155
DpnI GATC 1 cut(s) 78
DpnII GATC 1 cut(s) 76
Eco130I CCWWGG 1 cut(s) 113
Eco57I CTGAAG 1 cut(s) 33
EcoT14I CCWWGG 1 cut(s) 113
ErhI CCWWGG 1 cut(s) 113
FaeI CATG 1 cut(s) 117
FaiI YATR 5 cut(s) 50, 60, 71, 81, 115
FatI CATG 1 cut(s) 113
FbaI TGATCA 1 cut(s) 76
Hin1II CATG 1 cut(s) 117
Hpy166II GTNNAC 1 cut(s) 152
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 8
HpyCH4III ACNGT 1 cut(s) 104
HpyF3I CTNAG 2 cut(s) 128, 155
Hsp92II CATG 1 cut(s) 117
Ksp22I TGATCA 1 cut(s) 76
Kzo9I GATC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 51
MalI GATC 1 cut(s) 78
MboI GATC 1 cut(s) 76
MfeI CAATTG 1 cut(s) 143
MluCI AATT 2 cut(s) 64, 143
MnlI CCTC 1 cut(s) 45
MunI CAATTG 1 cut(s) 143
NcoI CCATGG 1 cut(s) 113
NdeII GATC 1 cut(s) 76
NlaIII CATG 1 cut(s) 117
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
Sau3AI GATC 1 cut(s) 76
SetI ASST 2 cut(s) 49, 100
SgeI CNNG 3 cut(s) 50, 126, 131
Sse9I AATT 2 cut(s) 64, 143
StyI CCWWGG 1 cut(s) 113
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 1 cut(s) 123
TasI AATT 2 cut(s) 64, 143
TspDTI ATGAA 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.