RchiOBHm_Chr3g0447451

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
170384 .. 170602
219 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41491

Sequence Viewer

Length: 219 bp
ATGAAGGGAAATTTCATTTTGTTATTACCAGGTTTGAGATATGGTATAGTGGTGCTTGAAATTAGAAAATATGCTTTGATAGGACTTGATTTTTCAGGAGGAGGATTTGGATGCAGGCTGGTTTCAAAAGCGACACTACACCAACAAATGAATCAGACGACAGTTTTTCACTGTCGTCTGATAAGGCACGTTGCTGTTGTCTATCTCAATGTCGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.06

Weight (kDa)

10.03

Isoelectric Point (pI)

20.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019397)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 10
AgsI TTSAA 2 cut(s) 59, 126
AjnI CCWGG 1 cut(s) 28
ApoI RAATTY 1 cut(s) 10
BciT130I CCWGG 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 101
BseBI CCWGG 1 cut(s) 30
BseGI GGATG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 30
Bst4CI ACNGT 2 cut(s) 163, 173
BstC8I GCNNGC 1 cut(s) 116
BstF5I GGATG 1 cut(s) 116
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BtsCI GGATG 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 116
CsiI ACCWGGT 1 cut(s) 28
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
EcoRII CCWGG 1 cut(s) 28
FaiI YATR 3 cut(s) 42, 47, 72
FokI GGATG 1 cut(s) 123
HinfI GANTC 1 cut(s) 151
Hpy188I TCNGA 3 cut(s) 156, 180, 218
Hpy188III TCNNGA 1 cut(s) 96
HpyCH4III ACNGT 2 cut(s) 163, 173
HpyCH4IV ACGT 1 cut(s) 189
HpyCH4V TGCA 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 189
LpnPI CCDG 5 cut(s) 15, 42, 81, 100, 104
LweI GCATC 1 cut(s) 101
MabI ACCWGGT 1 cut(s) 28
MaeII ACGT 1 cut(s) 189
MluCI AATT 2 cut(s) 10, 60
MnlI CCTC 2 cut(s) 92, 95
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
PfeI GAWTC 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
ScrFI CCNGG 1 cut(s) 30
SetI ASST 2 cut(s) 34, 192
SexAI ACCWGGT 1 cut(s) 28
SfaNI GCATC 1 cut(s) 101
SgeI CNNG 8 cut(s) 41, 42, 68, 98, 108, 127, 131, 200
Sse9I AATT 2 cut(s) 10, 60
StyD4I CCNGG 1 cut(s) 28
TaaI ACNGT 2 cut(s) 163, 173
TaiI ACGT 1 cut(s) 192
TasI AATT 2 cut(s) 10, 60
TfiI GAWTC 1 cut(s) 151
TscAI CASTG 1 cut(s) 176
TspDTI ATGAA 3 cut(s) 4, 17, 164
TspRI CASTG 1 cut(s) 176
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.