RchiOBHm_Chr4g0393081

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
8560573 .. 8561124
552 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36572

Sequence Viewer

Length: 249 bp
ATGCTCACAGACATAGAGAGCCAAGAGAGCAGAGGAACAAGGGACGGGGAAGCTCTCAGGGAAATCATCAATCTGGGCAGTCCAACTAATTCGATTTCTTGTATTGAACTGATGCGTATATATATTGGGGAATTTCAAAGAAGGCTTAAAAGTGTCAAAGATCGGCTCAGAGAGATGACGCTGTGGTTCGAACAAGTCATGCTTGAAGATGATGATGAACGAGTTTGGGATAACGTACCAGAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.72

Weight (kDa)

4.51

Isoelectric Point (pI)

57.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018170)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 131
AfaI GTAC 1 cut(s) 237
AgsI TTSAA 3 cut(s) 107, 137, 206
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
ApoI RAATTY 1 cut(s) 131
AsuII TTCGAA 1 cut(s) 189
BmsI GCATC 1 cut(s) 102
Bpu14I TTCGAA 1 cut(s) 189
BseMII CTCAG 2 cut(s) 70, 181
BslFI GGGAC 1 cut(s) 56
BsmFI GGGAC 1 cut(s) 56
Bsp119I TTCGAA 1 cut(s) 189
Bsp143I GATC 1 cut(s) 160
BspCNI CTCAG 2 cut(s) 69, 180
BspT104I TTCGAA 1 cut(s) 189
BssMI GATC 1 cut(s) 160
BstBI TTCGAA 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 56, 167
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 1 cut(s) 27
CseI GACGC 1 cut(s) 187
Csp6I GTAC 1 cut(s) 236
CviAII CATG 1 cut(s) 199
CviJI RGCY 4 cut(s) 21, 53, 145, 166
CviKI_1 RGCY 4 cut(s) 21, 53, 145, 166
CviQI GTAC 1 cut(s) 236
DdeI CTNAG 2 cut(s) 56, 167
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
FaeI CATG 1 cut(s) 202
FaiI YATR 5 cut(s) 14, 119, 121, 123, 200
FalI AAGNNNNNCTT 2 cut(s) 186, 218
FaqI GGGAC 1 cut(s) 56
FatI CATG 1 cut(s) 198
HgaI GACGC 1 cut(s) 187
Hin1II CATG 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 135
HpyCH4IV ACGT 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 27
HpyF3I CTNAG 2 cut(s) 56, 167
HpySE526I ACGT 1 cut(s) 234
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 2 cut(s) 43, 59
LweI GCATC 1 cut(s) 102
MaeII ACGT 1 cut(s) 234
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 1 cut(s) 218
MluCI AATT 3 cut(s) 88, 131, 244
MmeI TCCRAC 1 cut(s) 107
MnlI CCTC 1 cut(s) 26
MseI TTAA 2 cut(s) 147, 247
MwoI GCNNNNNNNGC 1 cut(s) 27
NdeII GATC 1 cut(s) 160
NlaIII CATG 1 cut(s) 202
NspV TTCGAA 1 cut(s) 189
RsaI GTAC 1 cut(s) 237
RsaNI GTAC 1 cut(s) 236
SaqAI TTAA 2 cut(s) 147, 247
Sau3AI GATC 1 cut(s) 160
SetI ASST 2 cut(s) 55, 237
SfaNI GCATC 1 cut(s) 102
SfuI TTCGAA 1 cut(s) 189
Sse9I AATT 3 cut(s) 88, 131, 244
TaiI ACGT 1 cut(s) 237
TaqI TCGA 2 cut(s) 92, 189
TasI AATT 3 cut(s) 88, 131, 244
Tru1I TTAA 2 cut(s) 147, 247
Tru9I TTAA 2 cut(s) 147, 247
TspDTI ATGAA 1 cut(s) 231
XapI RAATTY 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.