RchiOBHm_Chr4g0428281

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
53341474 .. 53341726
253 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39719

Sequence Viewer

Length: 141 bp
ATGAAAGACTCGATCAAAGGCATGAACGGCCAGGACGTTGACGACTGCAACATCATCGTCAACCAGGCGGGAATTATAGAGGAAGATCTGATGTACTTGCTGGTGGATCTCAACTACACCAAAGATCACGATCGCCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.25

Weight (kDa)

4.16

Isoelectric Point (pI)

35.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019404)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AclWI GGATC 1 cut(s) 114
AcoI YGGCCR 1 cut(s) 28
AfaI GTAC 1 cut(s) 95
AjnI CCWGG 2 cut(s) 30, 63
AlwI GGATC 1 cut(s) 114
AoxI GGCC 1 cut(s) 28
BceAI ACGGC 1 cut(s) 43
BcgI CGANNNNNNTGC 2 cut(s) 37, 71
BciT130I CCWGG 2 cut(s) 32, 65
BglII AGATCT 1 cut(s) 85
Bme1390I CCNGG 2 cut(s) 32, 65
BmrFI CCNGG 2 cut(s) 32, 65
BsaBI GATNNNNATC 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 129
BseBI CCWGG 2 cut(s) 32, 65
BseJI GATNNNNATC 1 cut(s) 129
Bsh1285I CGRYCG 1 cut(s) 133
BshFI GGCC 1 cut(s) 30
BsiEI CGRYCG 1 cut(s) 133
BsnI GGCC 1 cut(s) 30
Bsp143I GATC 5 cut(s) 12, 85, 106, 124, 130
BspACI CCGC 1 cut(s) 68
BspANI GGCC 1 cut(s) 30
BspPI GGATC 1 cut(s) 114
BssMI GATC 5 cut(s) 12, 85, 106, 124, 130
Bst2UI CCWGG 2 cut(s) 32, 65
BstKTI GATC 5 cut(s) 15, 88, 109, 127, 133
BstMBI GATC 5 cut(s) 12, 85, 106, 124, 130
BstMCI CGRYCG 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 27
BstNI CCWGG 2 cut(s) 32, 65
BstSCI CCNGG 2 cut(s) 30, 63
BstX2I RGATCY 2 cut(s) 85, 106
BstYI RGATCY 2 cut(s) 85, 106
BsuRI GGCC 1 cut(s) 30
Csp6I GTAC 1 cut(s) 94
CviAII CATG 1 cut(s) 22
CviJI RGCY 1 cut(s) 30
CviKI_1 RGCY 1 cut(s) 30
CviQI GTAC 1 cut(s) 94
DpnI GATC 5 cut(s) 14, 87, 108, 126, 132
DpnII GATC 5 cut(s) 12, 85, 106, 124, 130
EaeI YGGCCR 1 cut(s) 28
EcoRII CCWGG 2 cut(s) 30, 63
FaeI CATG 1 cut(s) 25
FaiI YATR 2 cut(s) 23, 77
FatI CATG 1 cut(s) 21
FauI CCCGC 1 cut(s) 61
HaeIII GGCC 1 cut(s) 30
Hin1II CATG 1 cut(s) 25
HincII GTYRAC 2 cut(s) 40, 61
HindII GTYRAC 2 cut(s) 40, 61
HinfI GANTC 1 cut(s) 8
Hpy166II GTNNAC 2 cut(s) 40, 61
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 128
Hpy8I GTNNAC 2 cut(s) 40, 61
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 1 cut(s) 48
HpyF10VI GCNNNNNNNGC 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 36
Hsp92II CATG 1 cut(s) 25
Kzo9I GATC 5 cut(s) 12, 85, 106, 124, 130
LpnPI CCDG 5 cut(s) 17, 44, 50, 77, 86
MaeII ACGT 1 cut(s) 36
MalI GATC 5 cut(s) 14, 87, 108, 126, 132
MboI GATC 5 cut(s) 12, 85, 106, 124, 130
MboII GAAGA 1 cut(s) 95
MflI RGATCY 2 cut(s) 85, 106
MluCI AATT 1 cut(s) 72
MlyI GAGTC 1 cut(s) 2
MnlI CCTC 1 cut(s) 73
MspR9I CCNGG 2 cut(s) 32, 65
MvaI CCWGG 2 cut(s) 32, 65
MwoI GCNNNNNNNGC 1 cut(s) 27
NdeII GATC 5 cut(s) 12, 85, 106, 124, 130
NlaIII CATG 1 cut(s) 25
PcsI WCGNNNNNNNCGW 1 cut(s) 33
Ple19I CGATCG 1 cut(s) 133
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
Psp6I CCWGG 2 cut(s) 30, 63
PspGI CCWGG 2 cut(s) 30, 63
PsuI RGATCY 2 cut(s) 85, 106
PvuI CGATCG 1 cut(s) 133
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
Sau3AI GATC 5 cut(s) 12, 85, 106, 124, 130
SchI GAGTC 1 cut(s) 2
ScrFI CCNGG 2 cut(s) 32, 65
SetI ASST 1 cut(s) 39
SgeI CNNG 9 cut(s) 22, 34, 43, 44, 76, 77, 81, 109, 113
Sse9I AATT 1 cut(s) 72
SsiI CCGC 1 cut(s) 68
StyD4I CCNGG 2 cut(s) 30, 63
TaiI ACGT 1 cut(s) 39
TaqI TCGA 1 cut(s) 11
TasI AATT 1 cut(s) 72
TatI WGTACW 1 cut(s) 93
TspDTI ATGAA 2 cut(s) 17, 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.