Rh7CG315200

RNA recognition motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
33647497 .. 33648759
1263 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG315200.1

Sequence Viewer

Length: 240 bp
ATGGCCTCTGCCGAGATCAAGTTCAATTGCTTCATCGGAGGGCTTGTCTGGGCCACCGATAACGATGACCAGATCATCCCCTTCAGCAATAAGAAGGCCATGAAAGACTTAATCAAAGGCATGAACTGCCAGGACGTTGACGACTGCAACATCATCGTCGACCAGGCGGGAATTATAGAGGAAGATCTGACGTACTTGCTGGTGGATCTCAACTACACCAAAGATCATGATCGCCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.92

Weight (kDa)

4.21

Isoelectric Point (pI)

26.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019404)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 159
AciI CCGC 1 cut(s) 167
AclWI GGATC 1 cut(s) 213
AcuI CTGAAG 1 cut(s) 67
AfaI GTAC 1 cut(s) 194
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 2 cut(s) 129, 162
AlwI GGATC 1 cut(s) 213
AoxI GGCC 3 cut(s) 3, 51, 96
AspS9I GGNCC 1 cut(s) 51
BcgI CGANNNNNNTGC 2 cut(s) 136, 170
BciT130I CCWGG 2 cut(s) 131, 164
BglII AGATCT 1 cut(s) 184
Bme1390I CCNGG 2 cut(s) 131, 164
BmgT120I GGNCC 1 cut(s) 51
BmrFI CCNGG 2 cut(s) 131, 164
BsaBI GATNNNNATC 1 cut(s) 228
BsaXI ACNNNNNCTCC 2 cut(s) 30, 60
Bse8I GATNNNNATC 1 cut(s) 228
BseBI CCWGG 2 cut(s) 131, 164
BseGI GGATG 1 cut(s) 75
BseJI GATNNNNATC 1 cut(s) 228
BshFI GGCC 3 cut(s) 5, 53, 98
BsnI GGCC 3 cut(s) 5, 53, 98
Bsp143I GATC 6 cut(s) 15, 72, 184, 205, 223, 229
BspACI CCGC 1 cut(s) 167
BspANI GGCC 3 cut(s) 5, 53, 98
BspHI TCATGA 1 cut(s) 226
BspPI GGATC 1 cut(s) 213
BssMI GATC 6 cut(s) 15, 72, 184, 205, 223, 229
Bst2UI CCWGG 2 cut(s) 131, 164
BstAPI GCANNNNNTGC 1 cut(s) 126
BstF5I GGATG 1 cut(s) 75
BstKTI GATC 6 cut(s) 18, 75, 187, 208, 226, 232
BstMBI GATC 6 cut(s) 15, 72, 184, 205, 223, 229
BstMWI GCNNNNNNNGC 1 cut(s) 126
BstNI CCWGG 2 cut(s) 131, 164
BstSCI CCNGG 2 cut(s) 129, 162
BstX2I RGATCY 2 cut(s) 184, 205
BstYI RGATCY 2 cut(s) 184, 205
BsuRI GGCC 3 cut(s) 5, 53, 98
BtsCI GGATG 1 cut(s) 75
CciI TCATGA 1 cut(s) 226
Cfr13I GGNCC 1 cut(s) 51
Csp6I GTAC 1 cut(s) 193
CviAII CATG 3 cut(s) 100, 121, 227
CviJI RGCY 4 cut(s) 5, 43, 53, 98
CviKI_1 RGCY 4 cut(s) 5, 43, 53, 98
CviQI GTAC 1 cut(s) 193
DpnI GATC 6 cut(s) 17, 74, 186, 207, 225, 231
DpnII GATC 6 cut(s) 15, 72, 184, 205, 223, 229
Eco57I CTGAAG 1 cut(s) 67
EcoRII CCWGG 2 cut(s) 129, 162
FaeI CATG 3 cut(s) 103, 124, 230
FaiI YATR 4 cut(s) 101, 122, 176, 228
FatI CATG 3 cut(s) 99, 120, 226
FauI CCCGC 1 cut(s) 160
FblI GTMKAC 1 cut(s) 159
FokI GGATG 1 cut(s) 62
HaeIII GGCC 3 cut(s) 5, 53, 98
Hin1II CATG 3 cut(s) 103, 124, 230
HincII GTYRAC 2 cut(s) 139, 160
HindII GTYRAC 2 cut(s) 139, 160
Hpy166II GTNNAC 2 cut(s) 139, 160
Hpy188I TCNGA 2 cut(s) 38, 189
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 2 cut(s) 139, 160
Hpy99I CGWCG 1 cut(s) 161
HpyAV CCTTC 2 cut(s) 88, 91
HpyCH4IV ACGT 2 cut(s) 135, 191
HpyCH4V TGCA 1 cut(s) 147
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpySE526I ACGT 2 cut(s) 135, 191
Hsp92II CATG 3 cut(s) 103, 124, 230
Kzo9I GATC 6 cut(s) 15, 72, 184, 205, 223, 229
LpnPI CCDG 7 cut(s) 34, 83, 116, 143, 149, 176, 185
MaeII ACGT 2 cut(s) 135, 191
MalI GATC 6 cut(s) 17, 74, 186, 207, 225, 231
MboI GATC 6 cut(s) 15, 72, 184, 205, 223, 229
MboII GAAGA 1 cut(s) 194
MfeI CAATTG 1 cut(s) 25
MflI RGATCY 2 cut(s) 184, 205
MluCI AATT 2 cut(s) 25, 171
MnlI CCTC 3 cut(s) 16, 32, 172
MseI TTAA 1 cut(s) 110
MspR9I CCNGG 2 cut(s) 131, 164
MunI CAATTG 1 cut(s) 25
MvaI CCWGG 2 cut(s) 131, 164
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 6 cut(s) 15, 72, 184, 205, 223, 229
NlaIII CATG 3 cut(s) 103, 124, 230
NmeAIII GCCGAG 1 cut(s) 37
PagI TCATGA 1 cut(s) 226
Psp6I CCWGG 2 cut(s) 129, 162
PspGI CCWGG 2 cut(s) 129, 162
PspPI GGNCC 1 cut(s) 51
PsuI RGATCY 2 cut(s) 184, 205
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
SalI GTCGAC 1 cut(s) 158
SaqAI TTAA 1 cut(s) 110
Sau3AI GATC 6 cut(s) 15, 72, 184, 205, 223, 229
Sau96I GGNCC 1 cut(s) 51
ScrFI CCNGG 2 cut(s) 131, 164
SetI ASST 2 cut(s) 138, 194
Sse9I AATT 2 cut(s) 25, 171
SsiI CCGC 1 cut(s) 167
StyD4I CCNGG 2 cut(s) 129, 162
TaiI ACGT 2 cut(s) 138, 194
TaqI TCGA 1 cut(s) 159
TasI AATT 2 cut(s) 25, 171
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TspDTI ATGAA 3 cut(s) 22, 116, 137
XmiI GTMKAC 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.