Rh1CG136500

RNA recognition motif

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
29953529 .. 29954138
610 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG136500.1

Sequence Viewer

Length: 234 bp
ATGAATCCTACTCTTGCAGAATCTTTTGCCCAGGTTTCATTTTCAGAACATTACAAAGATCACCAGATCATCACCTTCAGTAATAAGAAGGCCATGAAAGACTCGATCAAAGGCATGAACGGCCAGGACGTTGACGACTGCAACATCATCGTCGACCAGGCGGGAATTATAGAGGAAGATCTTATGTACTTGCTGGTGGATCTCGACTACACCAAAGATCATGATCGCCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.81

Weight (kDa)

4.47

Isoelectric Point (pI)

37.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019404)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 153
AciI CCGC 1 cut(s) 161
AclWI GGATC 1 cut(s) 207
AcoI YGGCCR 1 cut(s) 121
AcuI CTGAAG 1 cut(s) 61
AfaI GTAC 1 cut(s) 188
AjnI CCWGG 3 cut(s) 30, 123, 156
AlwI GGATC 1 cut(s) 207
AoxI GGCC 2 cut(s) 90, 121
AsuHPI GGTGA 2 cut(s) 53, 64
BceAI ACGGC 1 cut(s) 136
BcgI CGANNNNNNTGC 2 cut(s) 130, 164
BciT130I CCWGG 3 cut(s) 32, 125, 158
BglII AGATCT 1 cut(s) 178
Bme1390I CCNGG 3 cut(s) 32, 125, 158
BmrFI CCNGG 3 cut(s) 32, 125, 158
BsaBI GATNNNNATC 1 cut(s) 222
BsaJI CCNNGG 1 cut(s) 30
Bse8I GATNNNNATC 1 cut(s) 222
BseBI CCWGG 3 cut(s) 32, 125, 158
BseDI CCNNGG 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 222
BshFI GGCC 2 cut(s) 92, 123
BsnI GGCC 2 cut(s) 92, 123
Bsp143I GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
BspACI CCGC 1 cut(s) 161
BspANI GGCC 2 cut(s) 92, 123
BspHI TCATGA 1 cut(s) 220
BspPI GGATC 1 cut(s) 207
BssECI CCNNGG 1 cut(s) 30
BssMI GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
Bst2UI CCWGG 3 cut(s) 32, 125, 158
BstKTI GATC 7 cut(s) 61, 69, 108, 181, 202, 220, 226
BstMBI GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
BstMWI GCNNNNNNNGC 1 cut(s) 120
BstNI CCWGG 3 cut(s) 32, 125, 158
BstSCI CCNGG 3 cut(s) 30, 123, 156
BstX2I RGATCY 2 cut(s) 178, 199
BstYI RGATCY 2 cut(s) 178, 199
BsuRI GGCC 2 cut(s) 92, 123
CciI TCATGA 1 cut(s) 220
Csp6I GTAC 1 cut(s) 187
CviAII CATG 3 cut(s) 94, 115, 221
CviJI RGCY 2 cut(s) 92, 123
CviKI_1 RGCY 2 cut(s) 92, 123
CviQI GTAC 1 cut(s) 187
DpnI GATC 7 cut(s) 60, 68, 107, 180, 201, 219, 225
DpnII GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
EaeI YGGCCR 1 cut(s) 121
Eco57I CTGAAG 1 cut(s) 61
EcoRII CCWGG 3 cut(s) 30, 123, 156
FaeI CATG 3 cut(s) 97, 118, 224
FaiI YATR 5 cut(s) 95, 116, 170, 185, 222
FatI CATG 3 cut(s) 93, 114, 220
FauI CCCGC 1 cut(s) 154
FblI GTMKAC 1 cut(s) 153
HaeIII GGCC 2 cut(s) 92, 123
Hin1II CATG 3 cut(s) 97, 118, 224
HincII GTYRAC 2 cut(s) 133, 154
HindII GTYRAC 2 cut(s) 133, 154
HinfI GANTC 3 cut(s) 4, 20, 101
HphI GGTGA 2 cut(s) 53, 64
Hpy166II GTNNAC 2 cut(s) 133, 154
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 2 cut(s) 203, 221
Hpy8I GTNNAC 2 cut(s) 133, 154
Hpy99I CGWCG 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 82, 85
HpyCH4IV ACGT 1 cut(s) 129
HpyCH4V TGCA 2 cut(s) 17, 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
HpySE526I ACGT 1 cut(s) 129
Hsp92II CATG 3 cut(s) 97, 118, 224
Kzo9I GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
LpnPI CCDG 8 cut(s) 17, 44, 77, 110, 137, 143, 170, 179
MaeII ACGT 1 cut(s) 129
MalI GATC 7 cut(s) 60, 68, 107, 180, 201, 219, 225
MboI GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
MboII GAAGA 1 cut(s) 188
MflI RGATCY 2 cut(s) 178, 199
MluCI AATT 1 cut(s) 165
MlyI GAGTC 1 cut(s) 95
MnlI CCTC 1 cut(s) 166
MspR9I CCNGG 3 cut(s) 32, 125, 158
MvaI CCWGG 3 cut(s) 32, 125, 158
MwoI GCNNNNNNNGC 1 cut(s) 120
NdeII GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
NlaIII CATG 3 cut(s) 97, 118, 224
PagI TCATGA 1 cut(s) 220
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PfeI GAWTC 2 cut(s) 4, 20
PleI GAGTC 1 cut(s) 95
PpsI GAGTC 1 cut(s) 95
Psp6I CCWGG 3 cut(s) 30, 123, 156
PspGI CCWGG 3 cut(s) 30, 123, 156
PsuI RGATCY 2 cut(s) 178, 199
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SalI GTCGAC 1 cut(s) 152
Sau3AI GATC 7 cut(s) 58, 66, 105, 178, 199, 217, 223
SchI GAGTC 1 cut(s) 95
ScrFI CCNGG 3 cut(s) 32, 125, 158
SetI ASST 3 cut(s) 36, 77, 132
Sse9I AATT 1 cut(s) 165
SsiI CCGC 1 cut(s) 161
StyD4I CCNGG 3 cut(s) 30, 123, 156
TaiI ACGT 1 cut(s) 132
TaqI TCGA 3 cut(s) 104, 153, 204
TasI AATT 1 cut(s) 165
TatI WGTACW 1 cut(s) 186
TfiI GAWTC 2 cut(s) 4, 20
TspDTI ATGAA 4 cut(s) 17, 27, 110, 131
XmiI GTMKAC 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.