Rroxscaffold_1G00017400

RNA recognition motif

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
21500315 .. 21505452
5138 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00017400.1

Sequence Viewer

Length: 234 bp
ATGTCCTCTGCCGAGATCAAGTTCAATTGCTTCATCGGAGGGCTCGTACGGGCCACCGATAACGGTGTGCTCGAAAGGACTTTCACTTTTGGCGAGATCATCCAATCGAAGGTCCGTTTGTTGCGAGATCAGATCGGATCTGAATCGGTGCTCATTGATCTCTACTGGTTTCTACCTACTTGTGGTGATATAGACCCCAGAAGAAATCTTCTATATGTGAATGTAATGGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.76

Weight (kDa)

5.17

Isoelectric Point (pI)

44.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019404)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 145
AfaI GTAC 1 cut(s) 48
AfiI CCNNNNNNNGG 2 cut(s) 109, 182
AgsI TTSAA 1 cut(s) 25
Alw21I GWGCWC 2 cut(s) 72, 153
AlwI GGATC 1 cut(s) 145
AoxI GGCC 1 cut(s) 51
AspS9I GGNCC 2 cut(s) 51, 112
AsuHPI GGTGA 1 cut(s) 197
AvaII GGWCC 1 cut(s) 112
BanII GRGCYC 1 cut(s) 45
Bbv12I GWGCWC 2 cut(s) 72, 153
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 2 cut(s) 51, 112
BsaBI GATNNNNATC 1 cut(s) 142
BsaXI ACNNNNNCTCC 2 cut(s) 30, 60
Bsc4I CCNNNNNNNGG 2 cut(s) 109, 182
Bse1I ACTGG 1 cut(s) 170
Bse8I GATNNNNATC 1 cut(s) 142
BseGI GGATG 1 cut(s) 99
BseJI GATNNNNATC 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 109, 182
BseNI ACTGG 1 cut(s) 170
BshFI GGCC 1 cut(s) 53
BsiHKAI GWGCWC 2 cut(s) 72, 153
BsiWI CGTACG 1 cut(s) 46
BslI CCNNNNNNNGG 2 cut(s) 109, 182
BsnI GGCC 1 cut(s) 53
Bsp1286I GDGCHC 3 cut(s) 45, 72, 153
Bsp143I GATC 6 cut(s) 15, 96, 127, 132, 137, 157
BspANI GGCC 1 cut(s) 53
BspPI GGATC 1 cut(s) 145
BsrI ACTGG 1 cut(s) 170
BssMI GATC 6 cut(s) 15, 96, 127, 132, 137, 157
Bst4CI ACNGT 1 cut(s) 65
BstF5I GGATG 1 cut(s) 99
BstKTI GATC 6 cut(s) 18, 99, 130, 135, 140, 160
BstMBI GATC 6 cut(s) 15, 96, 127, 132, 137, 157
BstX2I RGATCY 1 cut(s) 137
BstYI RGATCY 1 cut(s) 137
BsuRI GGCC 1 cut(s) 53
BtsCI GGATG 1 cut(s) 99
Cfr13I GGNCC 2 cut(s) 51, 112
Csp6I GTAC 1 cut(s) 47
CviJI RGCY 2 cut(s) 43, 53
CviKI_1 RGCY 2 cut(s) 43, 53
CviQI GTAC 1 cut(s) 47
DpnI GATC 6 cut(s) 17, 98, 129, 134, 139, 159
DpnII GATC 6 cut(s) 15, 96, 127, 132, 137, 157
Eco24I GRGCYC 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 112
EcoT38I GRGCYC 1 cut(s) 45
FaiI YATR 3 cut(s) 191, 214, 216
FokI GGATG 1 cut(s) 86
FriOI GRGCYC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 53
HinfI GANTC 1 cut(s) 143
HphI GGTGA 1 cut(s) 197
Hpy188I TCNGA 5 cut(s) 38, 132, 137, 142, 233
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 65
Kzo9I GATC 6 cut(s) 15, 96, 127, 132, 137, 157
LpnPI CCDG 2 cut(s) 151, 211
MalI GATC 6 cut(s) 17, 98, 129, 134, 139, 159
MboI GATC 6 cut(s) 15, 96, 127, 132, 137, 157
MboII GAAGA 2 cut(s) 200, 213
MfeI CAATTG 1 cut(s) 25
MflI RGATCY 1 cut(s) 137
MhlI GDGCHC 3 cut(s) 45, 72, 153
MluCI AATT 1 cut(s) 25
MnlI CCTC 2 cut(s) 16, 32
MunI CAATTG 1 cut(s) 25
NdeII GATC 6 cut(s) 15, 96, 127, 132, 137, 157
NmeAIII GCCGAG 1 cut(s) 37
PcsI WCGNNNNNNNCGW 2 cut(s) 42, 69
PfeI GAWTC 1 cut(s) 143
Pfl23II CGTACG 1 cut(s) 46
PspLI CGTACG 1 cut(s) 46
PspPI GGNCC 2 cut(s) 51, 112
PsuI RGATCY 1 cut(s) 137
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
Sau3AI GATC 6 cut(s) 15, 96, 127, 132, 137, 157
Sau96I GGNCC 2 cut(s) 51, 112
SduI GDGCHC 3 cut(s) 45, 72, 153
SetI ASST 2 cut(s) 114, 178
SinI GGWCC 1 cut(s) 112
Sse9I AATT 1 cut(s) 25
TaaI ACNGT 1 cut(s) 65
TaqI TCGA 2 cut(s) 72, 107
TasI AATT 1 cut(s) 25
TfiI GAWTC 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 22
TspGWI ACGGA 1 cut(s) 104
VpaK11BI GGWCC 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.