RchiOBHm_Chr5g0007131

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
4477003 .. 4481247
4245 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28822

Sequence Viewer

Length: 129 bp
ATGAGCGGTATATCAACTCGAGGTCTCACGTGGTTGATTTCATCTTGGTCAAAAGAATGGCTAGTCAGATTTCATCTCATTGATAGGCAAGCCCGCTGGATTCCAGTTTGGAGGCTTAGTCCCCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

5.09

Weight (kDa)

11.83

Isoelectric Point (pI)

54.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 6
AciI CCGC 2 cut(s) 6, 94
AcvI CACGTG 1 cut(s) 30
Alw26I GTCTC 1 cut(s) 29
Ama87I CYCGRG 1 cut(s) 18
AvaI CYCGRG 1 cut(s) 18
BbrPI CACGTG 1 cut(s) 30
BcoDI GTCTC 1 cut(s) 29
BfaI CTAG 1 cut(s) 62
BmeT110I CYCGRG 1 cut(s) 18
BmrI ACTGGG 1 cut(s) 118
BmuI ACTGGG 1 cut(s) 118
BsaAI YACGTR 1 cut(s) 30
BsaI GGTCTC 1 cut(s) 29
BsaXI ACNNNNNCTCC 1 cut(s) 103
Bse1I ACTGG 2 cut(s) 104, 124
BseNI ACTGG 2 cut(s) 104, 124
BsiHKCI CYCGRG 1 cut(s) 18
BslFI GGGAC 1 cut(s) 105
BsmAI GTCTC 1 cut(s) 29
BsmFI GGGAC 1 cut(s) 105
Bso31I GGTCTC 1 cut(s) 29
BsoBI CYCGRG 1 cut(s) 18
BspACI CCGC 2 cut(s) 6, 94
BspTNI GGTCTC 1 cut(s) 29
BsrBI CCGCTC 1 cut(s) 6
BsrI ACTGG 2 cut(s) 104, 124
BstBAI YACGTR 1 cut(s) 30
BstC8I GCNNGC 2 cut(s) 90, 94
BstDEI CTNAG 1 cut(s) 116
BstMAI GTCTC 1 cut(s) 29
Cac8I GCNNGC 2 cut(s) 90, 94
CviJI RGCY 3 cut(s) 61, 92, 115
CviKI_1 RGCY 3 cut(s) 61, 92, 115
DdeI CTNAG 1 cut(s) 116
Eco31I GGTCTC 1 cut(s) 29
Eco72I CACGTG 1 cut(s) 30
Eco88I CYCGRG 1 cut(s) 18
FaiI YATR 1 cut(s) 11
FaqI GGGAC 1 cut(s) 105
FauI CCCGC 1 cut(s) 101
FspBI CTAG 1 cut(s) 62
HinfI GANTC 1 cut(s) 100
Hpy188I TCNGA 1 cut(s) 68
HpyCH4IV ACGT 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 29
LpnPI CCDG 2 cut(s) 82, 117
MaeI CTAG 1 cut(s) 62
MaeII ACGT 1 cut(s) 29
MbiI CCGCTC 1 cut(s) 6
MnlI CCTC 2 cut(s) 14, 105
MspA1I CMGCKG 1 cut(s) 96
PaeR7I CTCGAG 1 cut(s) 18
PfeI GAWTC 1 cut(s) 100
PmaCI CACGTG 1 cut(s) 30
PmlI CACGTG 1 cut(s) 30
Ppu21I YACGTR 1 cut(s) 30
PspCI CACGTG 1 cut(s) 30
PspXI VCTCGAGB 1 cut(s) 18
SetI ASST 2 cut(s) 25, 32
Sfr274I CTCGAG 1 cut(s) 18
SlaI CTCGAG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 18
SmoI CTYRAG 1 cut(s) 18
SsiI CCGC 2 cut(s) 6, 94
SspMI CTAG 1 cut(s) 62
TaiI ACGT 1 cut(s) 32
TaqI TCGA 1 cut(s) 19
TfiI GAWTC 1 cut(s) 100
TspDTI ATGAA 2 cut(s) 30, 62
XhoI CTCGAG 1 cut(s) 18
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.