Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012775.1

Orthogroup ID

OG0014854

Physical Location & Seq

Genomic Coordinates Reverse (-)

3613 .. 4567

Gene Structure 955 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012775.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

atggactgtgaagtcattaggcacggagaaagccgttgcgttgctcctgccaagaactccagactatcacctctgcctccagaacgtgctggtttcaattatggtattggtgaaaccgttgatatacctattgatggaagtggggatttgaaaaagagggagagggaactccaagctaaagaagctgaactgagaaagtgtgaagagattgtaaaacggaaagaggatgctggagcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005769 GO:0005794 GO:0005802 GO:0005886 GO:0006810 GO:0006897 GO:0006898 GO:0008150 GO:0012505 GO:0016020 GO:0016192 GO:0031410 GO:0031982 GO:0031984 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0051179 GO:0051234 GO:0071944 GO:0097708 GO:0098657 GO:0098791

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SCAMP

Protein Analysis

79

Amino Acids

8.76

Weight (kDa)

5.86

Isoelectric Point (pI)

48.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014854)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0007131 RchiOBHm_Chr5g0007411
rosa_multiflora	Rmu_co8074744.1_g000001 Rmu_sc0012775.1_g000001
rosa_roxburghii	Rroxscaffold_1G00038990 Rroxscaffold_1G00069110 Rroxscaffold_4G00322800
rosa_samantha	Rh1AG289900 Rh3CG256800 Rh4BG047200 Rh5AG054900 Rh5BG234000 Rh5DG051600 Rh5DG384400 Rh5DG564000 Rh6CG209500 Rh7AG486500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	11
AfiI	CCNNNNNNNGG	1 cut(s)	134
AgsI	TTSAA	2 cut(s)	97, 151
AluBI	AGCT	2 cut(s)	176, 185
AluI	AGCT	2 cut(s)	176, 185
AsuHPI	GGTGA	2 cut(s)	60, 122
BccI	CCATC	1 cut(s)	128
BceAI	ACGGC	1 cut(s)	18
BmsI	GCATC	1 cut(s)	217
BpmI	CTGGAG	2 cut(s)	43, 63
Bsc4I	CCNNNNNNNGG	1 cut(s)	134
BseGI	GGATG	1 cut(s)	232
BseLI	CCNNNNNNNGG	1 cut(s)	134
BseMII	CTCAG	1 cut(s)	182
BslI	CCNNNNNNNGG	1 cut(s)	134
BspCNI	CTCAG	1 cut(s)	183
Bst4CI	ACNGT	2 cut(s)	8, 118
Bst6I	CTCTTC	1 cut(s)	198
BstDEI	CTNAG	1 cut(s)	191
BstF5I	GGATG	1 cut(s)	232
BstMWI	GCNNNNNNNGC	1 cut(s)	182
BtsCI	GGATG	1 cut(s)	232
CviAII	CATG	1 cut(s)	237
CviJI	RGCY	3 cut(s)	33, 176, 185
CviKI_1	RGCY	3 cut(s)	33, 176, 185
DdeI	CTNAG	1 cut(s)	191
DrdI	GACNNNNNNGTC	1 cut(s)	11
DseDI	GACNNNNNNGTC	1 cut(s)	11
Eam1104I	CTCTTC	1 cut(s)	198
EarI	CTCTTC	1 cut(s)	198
FaeI	CATG	1 cut(s)	240
FaiI	YATR	3 cut(s)	102, 125, 238
FatI	CATG	1 cut(s)	236
GsuI	CTGGAG	2 cut(s)	43, 63
Hin1II	CATG	1 cut(s)	240
HphI	GGTGA	2 cut(s)	60, 122
Hpy188III	TCNNGA	2 cut(s)	60, 80
HpyCH4III	ACNGT	2 cut(s)	8, 118
HpyCH4IV	ACGT	1 cut(s)	85
HpyF10VI	GCNNNNNNNGC	1 cut(s)	182
HpyF3I	CTNAG	1 cut(s)	191
HpySE526I	ACGT	1 cut(s)	85
Hsp92II	CATG	1 cut(s)	240
LmnI	GCTCC	2 cut(s)	49, 233
LpnPI	CCDG	5 cut(s)	60, 73, 75, 93, 216
LweI	GCATC	1 cut(s)	217
MaeII	ACGT	1 cut(s)	85
MboII	GAAGA	1 cut(s)	215
MluCI	AATT	1 cut(s)	97
MnlI	CCTC	5 cut(s)	81, 87, 150, 156, 217
MwoI	GCNNNNNNNGC	1 cut(s)	182
NlaIII	CATG	1 cut(s)	240
SetI	ASST	5 cut(s)	73, 88, 130, 178, 187
SfaNI	GCATC	1 cut(s)	217
SgeI	CNNG	8 cut(s)	35, 59, 64, 72, 92, 98, 102, 185
Sse9I	AATT	1 cut(s)	97
TaaI	ACNGT	2 cut(s)	8, 118
TaiI	ACGT	1 cut(s)	88
TasI	AATT	1 cut(s)	97
TspGWI	ACGGA	2 cut(s)	39, 232

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.