Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0019414

Physical Location & Seq

Genomic Coordinates Forward (+)

5288959 .. 5289333

Gene Structure 375 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ28925

Sequence Viewer

CDS Protein Promoter (2k)

Length: 375 bp

ATGAGCCAGTGGACATATTTTGCCCAGACCACCTGGTTGAGACGAGCAGGAGTTGGTTCTCTGGGTTGGCTTACTCCCAAGTCAGGTGAACTAGCTGTGAAATACTATAATGATCTCATTTATCTGTTCAACAAGAATATGGAAGACAATGGCAAGCCACAAGTGTTTCTTGGACATAGAAATAGAGACACGATAACAGGAGTGAGCTTCCTTGGCCCAAATGATGATTATGTCATGAGTGGGAGTATGTGTGGCCATGTATTTATTTGGAAGAAGAAGGAAGCTAAAGTAATTCTTGTTATCAAGGATACATCAGTTCAAATTGGGCCTCATACAAATTTGCCTATTATTAATTGCAACTTGTCGTGGGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005739 GO:0005829 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0019538 GO:0031461 GO:0031974 GO:0031981 GO:0032991 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043412 GO:0043687 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0070013 GO:0071704 GO:0080008 GO:1901564 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

124

Amino Acids

14.11

Weight (kDa)

8.93

Isoelectric Point (pI)

24.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019414)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0008271 RchiOBHm_Chr5g0008341
rosa_laevigata	RLG00000031557 RLG00000031562
rosa_roxburghii	Rroxscaffold_1G00066830 Rroxscaffold_1G00067530 Rroxscaffold_1G00068190
rosa_samantha	Rh5BG059700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	253
AcsI	RAATTY	1 cut(s)	337
AfiI	CCNNNNNNNGG	1 cut(s)	83
AgsI	TTSAA	2 cut(s)	130, 320
AjnI	CCWGG	1 cut(s)	32
AluBI	AGCT	3 cut(s)	95, 207, 284
AluI	AGCT	3 cut(s)	95, 207, 284
Alw26I	GTCTC	2 cut(s)	34, 180
AoxI	GGCC	3 cut(s)	214, 253, 326
ApoI	RAATTY	1 cut(s)	337
AseI	ATTAAT	1 cut(s)	351
AspS9I	GGNCC	2 cut(s)	215, 326
AsuHPI	GGTGA	1 cut(s)	98
BaeI	ACNNNNGTAYC	2 cut(s)	300, 333
BalI	TGGCCA	1 cut(s)	255
BbsI	GAAGAC	1 cut(s)	150
BciT130I	CCWGG	1 cut(s)	34
BciVI	GTATCC	1 cut(s)	301
BcoDI	GTCTC	2 cut(s)	34, 180
BfaI	CTAG	1 cut(s)	92
BfuI	GTATCC	1 cut(s)	301
Bme1390I	CCNGG	1 cut(s)	34
BmgT120I	GGNCC	2 cut(s)	215, 326
BmrFI	CCNGG	1 cut(s)	34
BpiI	GAAGAC	1 cut(s)	150
BsaJI	CCNNGG	1 cut(s)	211
BsaXI	ACNNNNNCTCC	2 cut(s)	235, 265
Bsc4I	CCNNNNNNNGG	1 cut(s)	83
Bse1I	ACTGG	1 cut(s)	7
BseBI	CCWGG	1 cut(s)	34
BseDI	CCNNGG	1 cut(s)	211
BseLI	CCNNNNNNNGG	1 cut(s)	83
BseNI	ACTGG	1 cut(s)	7
BshFI	GGCC	3 cut(s)	216, 255, 328
BslI	CCNNNNNNNGG	1 cut(s)	83
BsmAI	GTCTC	2 cut(s)	34, 180
BsmBI	CGTCTC	1 cut(s)	34
BsnI	GGCC	3 cut(s)	216, 255, 328
Bsp143I	GATC	1 cut(s)	112
BspANI	GGCC	3 cut(s)	216, 255, 328
BspHI	TCATGA	1 cut(s)	234
BsrI	ACTGG	1 cut(s)	7
BssECI	CCNNGG	1 cut(s)	211
BssMI	GATC	1 cut(s)	112
BssT1I	CCWWGG	1 cut(s)	211
Bst2UI	CCWGG	1 cut(s)	34
BstC8I	GCNNGC	1 cut(s)	155
BstKTI	GATC	1 cut(s)	115
BstMAI	GTCTC	2 cut(s)	34, 180
BstMBI	GATC	1 cut(s)	112
BstMWI	GCNNNNNNNGC	1 cut(s)	213
BstNI	CCWGG	1 cut(s)	34
BstSCI	CCNGG	1 cut(s)	32
BstV2I	GAAGAC	1 cut(s)	150
BsuI	GTATCC	1 cut(s)	301
BsuRI	GGCC	3 cut(s)	216, 255, 328
BtsIMutI	CAGTG	1 cut(s)	14
Cac8I	GCNNGC	1 cut(s)	155
CciI	TCATGA	1 cut(s)	234
Cfr13I	GGNCC	2 cut(s)	215, 326
CsiI	ACCWGGT	1 cut(s)	32
CviAII	CATG	2 cut(s)	235, 257
CviJI	RGCY	9 cut(s)	6, 70, 95, 157, 207, 216, 255, 284, 328
CviKI_1	RGCY	9 cut(s)	6, 70, 95, 157, 207, 216, 255, 284, 328
DpnI	GATC	1 cut(s)	114
DpnII	GATC	1 cut(s)	112
EaeI	YGGCCR	1 cut(s)	253
Eco130I	CCWWGG	1 cut(s)	211
EcoRII	CCWGG	1 cut(s)	32
EcoT14I	CCWWGG	1 cut(s)	211
ErhI	CCWWGG	1 cut(s)	211
Esp3I	CGTCTC	1 cut(s)	34
FaeI	CATG	2 cut(s)	238, 260
FaiI	YATR	9 cut(s)	16, 108, 140, 177, 231, 236, 248, 258, 333
FalI	AAGNNNNNCTT	4 cut(s)	153, 185, 279, 311
FatI	CATG	2 cut(s)	234, 256
FspBI	CTAG	1 cut(s)	92
HaeIII	GGCC	3 cut(s)	216, 255, 328
Hin1II	CATG	2 cut(s)	238, 260
HphI	GGTGA	1 cut(s)	98
Hpy166II	GTNNAC	2 cut(s)	12, 89
Hpy188III	TCNNGA	1 cut(s)	235
Hpy8I	GTNNAC	2 cut(s)	12, 89
HpyAV	CCTTC	1 cut(s)	271
HpyCH4V	TGCA	1 cut(s)	357
HpyF10VI	GCNNNNNNNGC	1 cut(s)	213
Hsp92II	CATG	2 cut(s)	238, 260
Kzo9I	GATC	1 cut(s)	112
LpnPI	CCDG	8 cut(s)	19, 20, 33, 38, 46, 47, 69, 183
MabI	ACCWGGT	1 cut(s)	32
MaeI	CTAG	1 cut(s)	92
MalI	GATC	1 cut(s)	114
MboI	GATC	1 cut(s)	112
MboII	GAAGA	3 cut(s)	155, 283, 286
MlsI	TGGCCA	1 cut(s)	255
MluCI	AATT	4 cut(s)	291, 321, 337, 352
MluNI	TGGCCA	1 cut(s)	255
MnlI	CCTC	1 cut(s)	339
Mox20I	TGGCCA	1 cut(s)	255
MscI	TGGCCA	1 cut(s)	255
MseI	TTAA	1 cut(s)	351
Msp20I	TGGCCA	1 cut(s)	255
MspR9I	CCNGG	1 cut(s)	34
MvaI	CCWGG	1 cut(s)	34
MwoI	GCNNNNNNNGC	1 cut(s)	213
NdeII	GATC	1 cut(s)	112
NlaIII	CATG	2 cut(s)	238, 260
PagI	TCATGA	1 cut(s)	234
PshBI	ATTAAT	1 cut(s)	351
Psp6I	CCWGG	1 cut(s)	32
PspGI	CCWGG	1 cut(s)	32
PspPI	GGNCC	2 cut(s)	215, 326
SaqAI	TTAA	1 cut(s)	351
Sau3AI	GATC	1 cut(s)	112
Sau96I	GGNCC	2 cut(s)	215, 326
ScrFI	CCNGG	1 cut(s)	34
SetI	ASST	5 cut(s)	35, 88, 97, 209, 286
SexAI	ACCWGGT	1 cut(s)	32
Sse9I	AATT	4 cut(s)	291, 321, 337, 352
SspMI	CTAG	1 cut(s)	92
StyD4I	CCNGG	1 cut(s)	32
StyI	CCWWGG	1 cut(s)	211
TasI	AATT	4 cut(s)	291, 321, 337, 352
Tru1I	TTAA	1 cut(s)	351
Tru9I	TTAA	1 cut(s)	351
TscAI	CASTG	1 cut(s)	14
TspRI	CASTG	1 cut(s)	14
VspI	ATTAAT	1 cut(s)	351
XapI	RAATTY	1 cut(s)	337
XspI	CTAG	1 cut(s)	92

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.