RchiOBHm_Chr6g0244351

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
475128 .. 475543
416 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21899

Sequence Viewer

Length: 324 bp
ATGGAGTTCCCTTGGAATTACATGCCGCATAATGAGATGGCCATCTTTCTTATTTGGATCATTGAGGCATGGTCAAGTTTCAAAGAAGTGGCAAAGATTGATACAACATTTCACACTACTGTGGGAGCTTTTGACGCTACTAGAACTAGTCTTGAGTTTGGTGCACATATGAGAAATACCAATTCAGCTGCTCGCATGTTTTCTTTTAGTGAGCGTCCATCAGAAGCAATGTGGTTGTCTGTAGACATCATGGAAGCTCAATATATGGGAAAGCTCGGAATTTGGTTGGTTATTGCTTCAGAATCAAATATTAACCAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.33

Weight (kDa)

5.0

Isoelectric Point (pI)

38.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 243
AciI CCGC 1 cut(s) 26
AclWI GGATC 1 cut(s) 65
AcoI YGGCCR 1 cut(s) 39
AcsI RAATTY 1 cut(s) 279
AcuI CTGAAG 1 cut(s) 282
AgsI TTSAA 1 cut(s) 82
AhlI ACTAGT 1 cut(s) 146
AleI CACNNNNGTG 1 cut(s) 119
AluBI AGCT 4 cut(s) 128, 188, 257, 274
AluI AGCT 4 cut(s) 128, 188, 257, 274
Alw21I GWGCWC 1 cut(s) 166
Alw44I GTGCAC 1 cut(s) 162
AlwI GGATC 1 cut(s) 65
AoxI GGCC 1 cut(s) 39
ApaLI GTGCAC 1 cut(s) 162
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 1 cut(s) 279
BaeGI GKGCMC 1 cut(s) 166
BalI TGGCCA 1 cut(s) 41
Bbv12I GWGCWC 1 cut(s) 166
BbvI GCAGC 1 cut(s) 175
BccI CCATC 3 cut(s) 31, 50, 226
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 2 cut(s) 141, 147
BfmI CTRYAG 1 cut(s) 240
BisI GCNGC 2 cut(s) 26, 189
BlsI GCNGC 2 cut(s) 27, 190
BpuEI CTTGAG 1 cut(s) 173
BsaBI GATNNNNATC 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 234
Bse8I GATNNNNATC 1 cut(s) 41
BseDI CCNNGG 1 cut(s) 11
BseJI GATNNNNATC 1 cut(s) 41
BseMI GCAATG 1 cut(s) 234
BseSI GKGCMC 1 cut(s) 166
BseXI GCAGC 1 cut(s) 175
BshFI GGCC 1 cut(s) 41
BsiHKAI GWGCWC 1 cut(s) 166
BsnI GGCC 1 cut(s) 41
Bsp1286I GDGCHC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 57
BspACI CCGC 1 cut(s) 26
BspANI GGCC 1 cut(s) 41
BspPI GGATC 1 cut(s) 65
BsrDI GCAATG 1 cut(s) 234
BssECI CCNNGG 1 cut(s) 11
BssMI GATC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 193
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNSI RCATGY 2 cut(s) 25, 199
BstSFI CTRYAG 1 cut(s) 240
BstSLI GKGCMC 1 cut(s) 166
BstV1I GCAGC 1 cut(s) 175
BsuRI GGCC 1 cut(s) 41
Cac8I GCNNGC 1 cut(s) 193
CseI GACGC 2 cut(s) 143, 203
CviAII CATG 4 cut(s) 22, 69, 196, 250
CviJI RGCY 5 cut(s) 41, 128, 188, 257, 274
CviKI_1 RGCY 5 cut(s) 41, 128, 188, 257, 274
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
EaeI YGGCCR 1 cut(s) 39
Eco130I CCWWGG 1 cut(s) 11
Eco57I CTGAAG 1 cut(s) 282
EcoT14I CCWWGG 1 cut(s) 11
ErhI CCWWGG 1 cut(s) 11
FaeI CATG 4 cut(s) 25, 72, 199, 253
FaiI YATR 9 cut(s) 23, 30, 70, 168, 170, 197, 251, 264, 266
FatI CATG 4 cut(s) 21, 68, 195, 249
FauNDI CATATG 1 cut(s) 168
FblI GTMKAC 1 cut(s) 243
Fnu4HI GCNGC 2 cut(s) 26, 189
Fsp4HI GCNGC 2 cut(s) 26, 189
FspBI CTAG 2 cut(s) 141, 147
GluI GCNGC 2 cut(s) 26, 189
HaeIII GGCC 1 cut(s) 41
HgaI GACGC 2 cut(s) 143, 203
Hin1II CATG 4 cut(s) 25, 72, 199, 253
HinfI GANTC 1 cut(s) 302
Hpy166II GTNNAC 2 cut(s) 164, 244
Hpy188I TCNGA 3 cut(s) 223, 278, 301
Hpy188III TCNNGA 1 cut(s) 152
Hpy8I GTNNAC 2 cut(s) 164, 244
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
Hsp92II CATG 4 cut(s) 25, 72, 199, 253
Kzo9I GATC 1 cut(s) 57
LmnI GCTCC 1 cut(s) 125
Lsp1109I GCAGC 1 cut(s) 175
MaeI CTAG 2 cut(s) 141, 147
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MhlI GDGCHC 1 cut(s) 166
MlsI TGGCCA 1 cut(s) 41
MluCI AATT 3 cut(s) 16, 181, 279
MluNI TGGCCA 1 cut(s) 41
MnlI CCTC 1 cut(s) 58
Mox20I TGGCCA 1 cut(s) 41
MscI TGGCCA 1 cut(s) 41
MseI TTAA 1 cut(s) 312
MslI CAYNNNNRTG 1 cut(s) 119
Msp20I TGGCCA 1 cut(s) 41
MspA1I CMGCKG 1 cut(s) 188
MwoI GCNNNNNNNGC 1 cut(s) 134
NdeI CATATG 1 cut(s) 168
NdeII GATC 1 cut(s) 57
NlaIII CATG 4 cut(s) 25, 72, 199, 253
NspI RCATGY 2 cut(s) 25, 199
OliI CACNNNNGTG 1 cut(s) 119
PfeI GAWTC 1 cut(s) 302
PkrI GCNGC 2 cut(s) 27, 190
PvuII CAGCTG 1 cut(s) 188
RseI CAYNNNNRTG 1 cut(s) 119
SaqAI TTAA 1 cut(s) 312
SatI GCNGC 2 cut(s) 26, 189
Sau3AI GATC 1 cut(s) 57
SduI GDGCHC 1 cut(s) 166
SetI ASST 4 cut(s) 130, 190, 259, 276
SfcI CTRYAG 1 cut(s) 240
SmiMI CAYNNNNRTG 1 cut(s) 119
SmlI CTYRAG 1 cut(s) 152
SmoI CTYRAG 1 cut(s) 152
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 3 cut(s) 16, 181, 279
SsiI CCGC 1 cut(s) 26
SspI AATATT 1 cut(s) 310
SspMI CTAG 2 cut(s) 141, 147
StyI CCWWGG 1 cut(s) 11
TaaI ACNGT 1 cut(s) 121
TasI AATT 3 cut(s) 16, 181, 279
TauI GCSGC 1 cut(s) 28
TfiI GAWTC 1 cut(s) 302
Tru1I TTAA 1 cut(s) 312
Tru9I TTAA 1 cut(s) 312
TseI GCWGC 1 cut(s) 188
VneI GTGCAC 1 cut(s) 162
XapI RAATTY 1 cut(s) 279
XceI RCATGY 2 cut(s) 25, 199
XmiI GTMKAC 1 cut(s) 243
XspI CTAG 2 cut(s) 141, 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.