RchiOBHm_Chr7g0202521

mitogen-activated protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
20110375 .. 20110739
365 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18129

Sequence Viewer

Length: 264 bp
ATGAAGCTTCTTCATCCGCTTCATCATCCTGATATTGTTGAAATAAAGCACATTATGCTCCCTTCTTCACGACAAAAATTCGGAGATATCTATGTTGTGTTTGAGTTGATGGAATCATACCTTCACCAGGTTATTAAGGCAAATGATGGTCTTAACCCTGAGCGTTATCAGTTTTTCCTATACCAGCTTGTTCCAAATGTATTTCATCAAGATTTAAAGCCAAAAAATAGCCTTACTAATGCTGACTGCAAATTAAAGATATGA

Protein Analysis

87

Amino Acids

10.29

Weight (kDa)

7.92

Isoelectric Point (pI)

21.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 2 - 87 4.2e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 17
AcsI RAATTY 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 127
AgsI TTSAA 1 cut(s) 41
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 2 cut(s) 7, 187
AluI AGCT 2 cut(s) 7, 187
ApoI RAATTY 1 cut(s) 77
AsuHPI GGTGA 1 cut(s) 116
BccI CCATC 2 cut(s) 103, 140
BciT130I CCWGG 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 128
Bpu10I CCTNAGC 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 127
BseBI CCWGG 1 cut(s) 128
BseGI GGATG 2 cut(s) 13, 25
BseLI CCNNNNNNNGG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 127
BspACI CCGC 1 cut(s) 17
BspCNI CTCAG 1 cut(s) 151
Bst2UI CCWGG 1 cut(s) 128
BstAPI GCANNNNNTGC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 159
BstENI CCTNNNNNAGG 1 cut(s) 125
BstF5I GGATG 2 cut(s) 13, 25
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
BtsCI GGATG 2 cut(s) 13, 25
CsiI ACCWGGT 1 cut(s) 126
CviJI RGCY 4 cut(s) 7, 187, 220, 231
CviKI_1 RGCY 4 cut(s) 7, 187, 220, 231
DdeI CTNAG 1 cut(s) 159
DraI TTTAAA 1 cut(s) 216
Eco32I GATATC 1 cut(s) 88
EcoNI CCTNNNNNAGG 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 126
EcoRV GATATC 1 cut(s) 88
FaiI YATR 5 cut(s) 56, 93, 118, 181, 262
FokI GGATG 1 cut(s) 12
HindIII AAGCTT 1 cut(s) 5
HinfI GANTC 1 cut(s) 113
HphI GGTGA 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 3 cut(s) 29, 69, 209
HpyAV CCTTC 2 cut(s) 72, 131
HpyCH4V TGCA 1 cut(s) 249
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HpyF3I CTNAG 1 cut(s) 159
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 5 cut(s) 42, 113, 140, 171, 197
MabI ACCWGGT 1 cut(s) 126
MboII GAAGA 1 cut(s) 57
MluCI AATT 2 cut(s) 77, 251
MseI TTAA 4 cut(s) 135, 153, 215, 254
MspR9I CCNGG 1 cut(s) 128
MvaI CCWGG 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 55
PfeI GAWTC 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
SaqAI TTAA 4 cut(s) 135, 153, 215, 254
ScrFI CCNGG 1 cut(s) 128
SetI ASST 4 cut(s) 9, 123, 132, 189
SexAI ACCWGGT 1 cut(s) 126
SgeI CNNG 8 cut(s) 41, 81, 139, 140, 170, 196, 200, 221
Sse9I AATT 2 cut(s) 77, 251
SsiI CCGC 1 cut(s) 17
StyD4I CCNGG 1 cut(s) 126
TasI AATT 2 cut(s) 77, 251
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 4 cut(s) 135, 153, 215, 254
Tru9I TTAA 4 cut(s) 135, 153, 215, 254
TspDTI ATGAA 3 cut(s) 11, 17, 194
XagI CCTNNNNNAGG 1 cut(s) 125
XapI RAATTY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.