RchiOBHm_Chr7g0223221

Serine hydroxymethyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
44884300 .. 44887820
3521 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19986

Sequence Viewer

Length: 465 bp
ATGGAGGCAGTTGGCTCAAGTCTCACAAACAAGTATTCGAAAGGATTACCTGGGAAAAGGTACACAGCTTGCGTCCTATGGTGGAAATGGCACATTGATGAGCTTGAAACACTAAGCCAAAAAAGGGCCCTGGATACATTTCACCTAGATGGAAAGAAGTGGGGCGTCAATGTTCAACCATTATCTGGTTCTCCAGCTAATTTCGAGGTTTATATAGCAGTTCTTAATCCTCATGATCGTATCATGCCTCTAAGGGGTCCAAGAGGTGGAATGATATTCTTCAAGAAGGATCCAGTTCTTGGAGTTGATGTAGAAACTGCCATCAACAATGCTGTTTTCCCGGCCTTACAGAGTGGTCCCCATAACCACACTATTGGGGGCCTTGCAGTTTGCTTAAAGCATGCTCAGTCCACAAAATTTAAGGCTTACCAGAATCAGTCATCAGAAAGTCAGAAATACATTTAG

Protein Analysis

154

Amino Acids

17.14

Weight (kDa)

9.39

Isoelectric Point (pI)

47.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SHMT PF00464 1 - 84 5.7e-29 Serine hydroxymethyltransferase
SHMT PF00464 84 - 150 7e-17 Serine hydroxymethyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018495)

Species Orthologous Gene IDs
malus_domestica MD09G1269200.v1.1
pyrus_communis pycom17g26660
rosa_chinensis RchiOBHm_Chr1g0360671 RchiOBHm_Chr7g0223221
rosa_multiflora Rmu_co8421897.1_g000001
rosa_roxburghii Rroxscaffold_4G00301080 Rroxscaffold_7G00212560
rosa_samantha Rh3BG358300 Rh6AG220400
rosa_wichuraiana Rw6G019320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 3 cut(s) 185, 266, 299
AclWI GGATC 2 cut(s) 284, 297
AcsI RAATTY 1 cut(s) 416
AcyI GRCGYC 1 cut(s) 165
AfaI GTAC 1 cut(s) 62
AfiI CCNNNNNNNGG 5 cut(s) 124, 185, 254, 266, 299
AgsI TTSAA 3 cut(s) 107, 176, 283
AjnI CCWGG 2 cut(s) 49, 129
AluBI AGCT 3 cut(s) 68, 103, 197
AluI AGCT 3 cut(s) 68, 103, 197
Alw26I GTCTC 1 cut(s) 26
AlwI GGATC 2 cut(s) 284, 297
AoxI GGCC 3 cut(s) 126, 342, 379
ApaI GGGCCC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 416
AspS9I GGNCC 5 cut(s) 126, 127, 257, 356, 379
AsuC2I CCSGG 1 cut(s) 341
AsuHPI GGTGA 1 cut(s) 134
AsuII TTCGAA 1 cut(s) 38
AvaII GGWCC 2 cut(s) 257, 356
BaeGI GKGCMC 1 cut(s) 130
BamHI GGATCC 1 cut(s) 289
BanII GRGCYC 1 cut(s) 130
BccI CCATC 2 cut(s) 143, 329
BciT130I CCWGG 2 cut(s) 51, 131
BciVI GTATCC 1 cut(s) 127
BcnI CCSGG 1 cut(s) 341
BcoDI GTCTC 1 cut(s) 26
BfaI CTAG 1 cut(s) 146
BfuI GTATCC 1 cut(s) 127
Bme1390I CCNGG 3 cut(s) 51, 131, 341
Bme18I GGWCC 2 cut(s) 257, 356
BmgT120I GGNCC 5 cut(s) 126, 127, 257, 356, 379
BmiI GGNNCC 5 cut(s) 128, 258, 291, 358, 380
BmrFI CCNGG 3 cut(s) 51, 131, 341
BpmI CTGGAG 1 cut(s) 177
Bpu14I TTCGAA 1 cut(s) 38
BpuMI CCSGG 1 cut(s) 341
BsaHI GRCGYC 1 cut(s) 165
BsaJI CCNNGG 2 cut(s) 50, 129
BsaXI ACNNNNNCTCC 2 cut(s) 294, 324
Bsc4I CCNNNNNNNGG 5 cut(s) 124, 185, 254, 266, 299
Bse1I ACTGG 1 cut(s) 293
BseBI CCWGG 2 cut(s) 51, 131
BseDI CCNNGG 2 cut(s) 50, 129
BseLI CCNNNNNNNGG 5 cut(s) 124, 185, 254, 266, 299
BseMII CTCAG 1 cut(s) 419
BseNI ACTGG 1 cut(s) 293
BseSI GKGCMC 1 cut(s) 130
BshFI GGCC 3 cut(s) 128, 344, 381
BsiSI CCGG 1 cut(s) 341
BslFI GGGAC 1 cut(s) 342
BslI CCNNNNNNNGG 5 cut(s) 124, 185, 254, 266, 299
BsmAI GTCTC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 342
BsnI GGCC 3 cut(s) 128, 344, 381
Bsp119I TTCGAA 1 cut(s) 38
Bsp120I GGGCCC 1 cut(s) 126
Bsp1286I GDGCHC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 235, 289
BspANI GGCC 3 cut(s) 128, 344, 381
BspCNI CTCAG 1 cut(s) 418
BspHI TCATGA 1 cut(s) 232
BspLI GGNNCC 5 cut(s) 128, 258, 291, 358, 380
BspPI GGATC 2 cut(s) 284, 297
BspT104I TTCGAA 1 cut(s) 38
BsrI ACTGG 1 cut(s) 293
BssECI CCNNGG 2 cut(s) 50, 129
BssMI GATC 2 cut(s) 235, 289
BssNI GRCGYC 1 cut(s) 165
Bst2UI CCWGG 2 cut(s) 51, 131
BstACI GRCGYC 1 cut(s) 165
BstBI TTCGAA 1 cut(s) 38
BstC8I GCNNGC 2 cut(s) 70, 402
BstDEI CTNAG 3 cut(s) 113, 251, 405
BstKTI GATC 2 cut(s) 238, 292
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 2 cut(s) 235, 289
BstNI CCWGG 2 cut(s) 51, 131
BstNSI RCATGY 1 cut(s) 404
BstSCI CCNGG 3 cut(s) 49, 129, 339
BstSLI GKGCMC 1 cut(s) 130
BstX2I RGATCY 1 cut(s) 289
BstXI CCANNNNNNTGG 1 cut(s) 374
BstYI RGATCY 1 cut(s) 289
BsuI GTATCC 1 cut(s) 127
BsuRI GGCC 3 cut(s) 128, 344, 381
Cac8I GCNNGC 2 cut(s) 70, 402
CciI TCATGA 1 cut(s) 232
Cfr13I GGNCC 5 cut(s) 126, 127, 257, 356, 379
CseI GACGC 2 cut(s) 61, 154
Csp6I GTAC 1 cut(s) 61
CviAII CATG 3 cut(s) 233, 244, 401
CviJI RGCY 9 cut(s) 15, 68, 103, 117, 128, 197, 344, 381, 425
CviKI_1 RGCY 9 cut(s) 15, 68, 103, 117, 128, 197, 344, 381, 425
CviQI GTAC 1 cut(s) 61
DdeI CTNAG 3 cut(s) 113, 251, 405
DpnI GATC 2 cut(s) 237, 291
DpnII GATC 2 cut(s) 235, 289
Eco24I GRGCYC 1 cut(s) 130
Eco47I GGWCC 2 cut(s) 257, 356
EcoO109I RGGNCCY 3 cut(s) 126, 127, 379
EcoRII CCWGG 2 cut(s) 49, 129
EcoT38I GRGCYC 1 cut(s) 130
FaeI CATG 3 cut(s) 236, 247, 404
FaiI YATR 7 cut(s) 79, 213, 215, 234, 245, 363, 402
FaqI GGGAC 1 cut(s) 342
FatI CATG 3 cut(s) 232, 243, 400
FriOI GRGCYC 1 cut(s) 130
FspBI CTAG 1 cut(s) 146
GsuI CTGGAG 1 cut(s) 177
HaeIII GGCC 3 cut(s) 128, 344, 381
HapII CCGG 1 cut(s) 341
HgaI GACGC 2 cut(s) 61, 154
Hin1I GRCGYC 1 cut(s) 165
Hin1II CATG 3 cut(s) 236, 247, 404
HinfI GANTC 1 cut(s) 433
HpaII CCGG 1 cut(s) 341
HphI GGTGA 1 cut(s) 134
Hpy166II GTNNAC 2 cut(s) 63, 411
Hpy188I TCNGA 2 cut(s) 445, 453
Hpy188III TCNNGA 2 cut(s) 233, 283
Hpy8I GTNNAC 2 cut(s) 63, 411
HpyAV CCTTC 1 cut(s) 280
HpyCH4V TGCA 1 cut(s) 386
HpyF3I CTNAG 3 cut(s) 113, 251, 405
Hsp92I GRCGYC 1 cut(s) 165
Hsp92II CATG 3 cut(s) 236, 247, 404
Kzo9I GATC 2 cut(s) 235, 289
LpnPI CCDG 9 cut(s) 36, 63, 116, 143, 171, 207, 306, 354, 443
MaeI CTAG 1 cut(s) 146
MalI GATC 2 cut(s) 237, 291
MboI GATC 2 cut(s) 235, 289
MboII GAAGA 1 cut(s) 271
MflI RGATCY 1 cut(s) 289
MhlI GDGCHC 1 cut(s) 130
MluCI AATT 2 cut(s) 199, 416
MnlI CCTC 4 cut(s) 199, 240, 257, 258
MseI TTAA 3 cut(s) 225, 395, 420
MslI CAYNNNNRTG 2 cut(s) 96, 147
MspI CCGG 1 cut(s) 341
MspR9I CCNGG 3 cut(s) 51, 131, 341
MvaI CCWGG 2 cut(s) 51, 131
NciI CCSGG 1 cut(s) 341
NdeII GATC 2 cut(s) 235, 289
NlaIII CATG 3 cut(s) 236, 247, 404
NlaIV GGNNCC 5 cut(s) 128, 258, 291, 358, 380
NspI RCATGY 1 cut(s) 404
NspV TTCGAA 1 cut(s) 38
PaeI GCATGC 1 cut(s) 404
PagI TCATGA 1 cut(s) 232
PfeI GAWTC 1 cut(s) 433
PflMI CCANNNNNTGG 3 cut(s) 185, 266, 299
Psp6I CCWGG 2 cut(s) 49, 129
PspGI CCWGG 2 cut(s) 49, 129
PspN4I GGNNCC 5 cut(s) 128, 258, 291, 358, 380
PspOMI GGGCCC 1 cut(s) 126
PspPI GGNCC 5 cut(s) 126, 127, 257, 356, 379
PsuI RGATCY 1 cut(s) 289
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
RseI CAYNNNNRTG 2 cut(s) 96, 147
SaqAI TTAA 3 cut(s) 225, 395, 420
Sau3AI GATC 2 cut(s) 235, 289
Sau96I GGNCC 5 cut(s) 126, 127, 257, 356, 379
ScrFI CCNGG 3 cut(s) 51, 131, 341
SduI GDGCHC 1 cut(s) 130
SetI ASST 8 cut(s) 52, 62, 70, 105, 147, 199, 210, 268
SfuI TTCGAA 1 cut(s) 38
SinI GGWCC 2 cut(s) 257, 356
SmiMI CAYNNNNRTG 2 cut(s) 96, 147
SmlI CTYRAG 1 cut(s) 16
SmoI CTYRAG 1 cut(s) 16
SphI GCATGC 1 cut(s) 404
Sse9I AATT 2 cut(s) 199, 416
SspMI CTAG 1 cut(s) 146
StyD4I CCNGG 3 cut(s) 49, 129, 339
TaqI TCGA 2 cut(s) 38, 204
TasI AATT 2 cut(s) 199, 416
TfiI GAWTC 1 cut(s) 433
Tru1I TTAA 3 cut(s) 225, 395, 420
Tru9I TTAA 3 cut(s) 225, 395, 420
Van91I CCANNNNNTGG 3 cut(s) 185, 266, 299
VpaK11BI GGWCC 2 cut(s) 257, 356
XapI RAATTY 1 cut(s) 416
XceI RCATGY 1 cut(s) 404
XspI CTAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.