Rw6G019320

Serine hydroxymethyltransferase

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Forward (+)
38520768 .. 38521714
947 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G019320.1

Sequence Viewer

Length: 471 bp
ATGGAGGCAGTTGGCTCATGTCTCACAAACAAGTATTCGGAAGGATTACCTGGGAAAAGGTACTATGGTGGAAATGAGCACATTGATGAGCTTGAAACACTAAGCCAAAAAAGGGCCCTGGATACATTTCACCTAGATGGAAAGAAGTGGGGCGTCAATGTTCAACCATTATCTGGTTCTCCAGCTAATTTCGAGGTTTATATAGCAGTTCTTAATCCTCATGATCGTATCATGCCTCTAAGGGGTCCAAGAGGTGGAATGATATTCTTCAAGAAGGATCCAGTTCTTGGAGTTGATTTAGAAACTGCCATCAACAATACTGTTTTCCCGGCCTTACAGCAACATTTATATTTTCAATGTAGACATAAAAGGCTTGACTTCTTGATACAGAGTGGTCCCCATAACCACACTATTGGGGGCCTTGCAGTTTGCTTAAAGCATGCTCAGTCCCCAGAATTTAAGGCTTACTAG

Protein Analysis

156

Amino Acids

17.47

Weight (kDa)

8.43

Isoelectric Point (pI)

47.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SHMT PF00464 1 - 80 8.8e-38 Serine hydroxymethyltransferase
SHMT PF00464 80 - 156 1.9e-09 Serine hydroxymethyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018495)

Species Orthologous Gene IDs
malus_domestica MD09G1269200.v1.1
pyrus_communis pycom17g26660
rosa_chinensis RchiOBHm_Chr1g0360671 RchiOBHm_Chr7g0223221
rosa_multiflora Rmu_co8421897.1_g000001
rosa_roxburghii Rroxscaffold_4G00301080 Rroxscaffold_7G00212560
rosa_samantha Rh3BG358300 Rh6AG220400
rosa_wichuraiana Rw6G019320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 3 cut(s) 173, 254, 287
AccI GTMKAC 1 cut(s) 361
AclWI GGATC 2 cut(s) 272, 285
AcsI RAATTY 1 cut(s) 455
AcyI GRCGYC 1 cut(s) 153
AfaI GTAC 1 cut(s) 62
AfiI CCNNNNNNNGG 5 cut(s) 112, 173, 242, 254, 287
AgsI TTSAA 4 cut(s) 95, 164, 271, 356
AjnI CCWGG 2 cut(s) 49, 117
AluBI AGCT 2 cut(s) 91, 185
AluI AGCT 2 cut(s) 91, 185
Alw21I GWGCWC 1 cut(s) 81
Alw26I GTCTC 1 cut(s) 26
AlwI GGATC 2 cut(s) 272, 285
AoxI GGCC 3 cut(s) 114, 330, 418
ApaI GGGCCC 1 cut(s) 118
ApoI RAATTY 1 cut(s) 455
AspS9I GGNCC 5 cut(s) 114, 115, 245, 395, 418
AsuC2I CCSGG 1 cut(s) 329
AsuHPI GGTGA 1 cut(s) 122
AvaII GGWCC 2 cut(s) 245, 395
BaeGI GKGCMC 1 cut(s) 118
BaeI ACNNNNGTAYC 2 cut(s) 52, 85
BamHI GGATCC 1 cut(s) 277
BanII GRGCYC 1 cut(s) 118
Bbv12I GWGCWC 1 cut(s) 81
BccI CCATC 2 cut(s) 131, 317
BciT130I CCWGG 2 cut(s) 51, 119
BciVI GTATCC 1 cut(s) 115
BcnI CCSGG 1 cut(s) 329
BcoDI GTCTC 1 cut(s) 26
BfaI CTAG 2 cut(s) 134, 469
BfuI GTATCC 1 cut(s) 115
Bme1390I CCNGG 3 cut(s) 51, 119, 329
Bme18I GGWCC 2 cut(s) 245, 395
BmgT120I GGNCC 5 cut(s) 114, 115, 245, 395, 418
BmiI GGNNCC 5 cut(s) 116, 246, 279, 397, 419
BmrFI CCNGG 3 cut(s) 51, 119, 329
BpmI CTGGAG 1 cut(s) 165
BpuMI CCSGG 1 cut(s) 329
BsaHI GRCGYC 1 cut(s) 153
BsaJI CCNNGG 2 cut(s) 50, 117
Bsc4I CCNNNNNNNGG 5 cut(s) 112, 173, 242, 254, 287
Bse1I ACTGG 1 cut(s) 281
BseBI CCWGG 2 cut(s) 51, 119
BseDI CCNNGG 2 cut(s) 50, 117
BseLI CCNNNNNNNGG 5 cut(s) 112, 173, 242, 254, 287
BseMII CTCAG 1 cut(s) 458
BseNI ACTGG 1 cut(s) 281
BseSI GKGCMC 1 cut(s) 118
BshFI GGCC 3 cut(s) 116, 332, 420
BsiHKAI GWGCWC 1 cut(s) 81
BsiSI CCGG 1 cut(s) 329
BslFI GGGAC 2 cut(s) 381, 433
BslI CCNNNNNNNGG 5 cut(s) 112, 173, 242, 254, 287
BsmAI GTCTC 1 cut(s) 26
BsmFI GGGAC 2 cut(s) 381, 433
BsnI GGCC 3 cut(s) 116, 332, 420
Bsp120I GGGCCC 1 cut(s) 114
Bsp1286I GDGCHC 2 cut(s) 81, 118
Bsp143I GATC 2 cut(s) 223, 277
BspANI GGCC 3 cut(s) 116, 332, 420
BspCNI CTCAG 1 cut(s) 457
BspHI TCATGA 1 cut(s) 220
BspLI GGNNCC 5 cut(s) 116, 246, 279, 397, 419
BspPI GGATC 2 cut(s) 272, 285
BsrI ACTGG 1 cut(s) 281
BssECI CCNNGG 2 cut(s) 50, 117
BssMI GATC 2 cut(s) 223, 277
BssNI GRCGYC 1 cut(s) 153
Bst2UI CCWGG 2 cut(s) 51, 119
Bst4CI ACNGT 1 cut(s) 322
BstACI GRCGYC 1 cut(s) 153
BstC8I GCNNGC 1 cut(s) 441
BstDEI CTNAG 3 cut(s) 101, 239, 444
BstKTI GATC 2 cut(s) 226, 280
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 2 cut(s) 223, 277
BstNI CCWGG 2 cut(s) 51, 119
BstNSI RCATGY 1 cut(s) 443
BstSCI CCNGG 3 cut(s) 49, 117, 327
BstSLI GKGCMC 1 cut(s) 118
BstX2I RGATCY 1 cut(s) 277
BstXI CCANNNNNNTGG 1 cut(s) 413
BstYI RGATCY 1 cut(s) 277
BsuI GTATCC 1 cut(s) 115
BsuRI GGCC 3 cut(s) 116, 332, 420
Cac8I GCNNGC 1 cut(s) 441
CciI TCATGA 1 cut(s) 220
Cfr13I GGNCC 5 cut(s) 114, 115, 245, 395, 418
CseI GACGC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 61
CviAII CATG 4 cut(s) 18, 221, 232, 440
CviJI RGCY 9 cut(s) 15, 91, 105, 116, 185, 332, 373, 420, 464
CviKI_1 RGCY 9 cut(s) 15, 91, 105, 116, 185, 332, 373, 420, 464
CviQI GTAC 1 cut(s) 61
DdeI CTNAG 3 cut(s) 101, 239, 444
DpnI GATC 2 cut(s) 225, 279
DpnII GATC 2 cut(s) 223, 277
Eco24I GRGCYC 1 cut(s) 118
Eco47I GGWCC 2 cut(s) 245, 395
EcoO109I RGGNCCY 3 cut(s) 114, 115, 418
EcoRII CCWGG 2 cut(s) 49, 117
EcoT38I GRGCYC 1 cut(s) 118
FaeI CATG 4 cut(s) 21, 224, 235, 443
FaqI GGGAC 2 cut(s) 381, 433
FatI CATG 4 cut(s) 17, 220, 231, 439
FblI GTMKAC 1 cut(s) 361
FriOI GRGCYC 1 cut(s) 118
FspBI CTAG 2 cut(s) 134, 469
GsuI CTGGAG 1 cut(s) 165
HaeIII GGCC 3 cut(s) 116, 332, 420
HapII CCGG 1 cut(s) 329
HgaI GACGC 1 cut(s) 142
Hin1I GRCGYC 1 cut(s) 153
Hin1II CATG 4 cut(s) 21, 224, 235, 443
HpaII CCGG 1 cut(s) 329
HphI GGTGA 1 cut(s) 122
Hpy166II GTNNAC 1 cut(s) 362
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 3 cut(s) 221, 271, 382
Hpy8I GTNNAC 1 cut(s) 362
HpyAV CCTTC 2 cut(s) 35, 268
HpyCH4III ACNGT 1 cut(s) 322
HpyCH4V TGCA 1 cut(s) 425
HpyF3I CTNAG 3 cut(s) 101, 239, 444
Hsp92I GRCGYC 1 cut(s) 153
Hsp92II CATG 4 cut(s) 21, 224, 235, 443
Kzo9I GATC 2 cut(s) 223, 277
LpnPI CCDG 9 cut(s) 36, 63, 104, 131, 159, 195, 294, 342, 465
MaeI CTAG 2 cut(s) 134, 469
MalI GATC 2 cut(s) 225, 279
MboI GATC 2 cut(s) 223, 277
MboII GAAGA 1 cut(s) 259
MflI RGATCY 1 cut(s) 277
MhlI GDGCHC 2 cut(s) 81, 118
MluCI AATT 2 cut(s) 187, 455
MnlI CCTC 4 cut(s) 187, 228, 245, 246
MseI TTAA 3 cut(s) 213, 434, 459
MslI CAYNNNNRTG 2 cut(s) 84, 135
MspI CCGG 1 cut(s) 329
MspR9I CCNGG 3 cut(s) 51, 119, 329
MvaI CCWGG 2 cut(s) 51, 119
NciI CCSGG 1 cut(s) 329
NdeII GATC 2 cut(s) 223, 277
NlaIII CATG 4 cut(s) 21, 224, 235, 443
NlaIV GGNNCC 5 cut(s) 116, 246, 279, 397, 419
NspI RCATGY 1 cut(s) 443
PaeI GCATGC 1 cut(s) 443
PagI TCATGA 1 cut(s) 220
PflMI CCANNNNNTGG 3 cut(s) 173, 254, 287
Psp6I CCWGG 2 cut(s) 49, 117
PspGI CCWGG 2 cut(s) 49, 117
PspN4I GGNNCC 5 cut(s) 116, 246, 279, 397, 419
PspOMI GGGCCC 1 cut(s) 114
PspPI GGNCC 5 cut(s) 114, 115, 245, 395, 418
PsuI RGATCY 1 cut(s) 277
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
RseI CAYNNNNRTG 2 cut(s) 84, 135
SaqAI TTAA 3 cut(s) 213, 434, 459
Sau3AI GATC 2 cut(s) 223, 277
Sau96I GGNCC 5 cut(s) 114, 115, 245, 395, 418
ScrFI CCNGG 3 cut(s) 51, 119, 329
SduI GDGCHC 2 cut(s) 81, 118
SetI ASST 7 cut(s) 52, 62, 93, 135, 187, 198, 256
SinI GGWCC 2 cut(s) 245, 395
SmiMI CAYNNNNRTG 2 cut(s) 84, 135
SphI GCATGC 1 cut(s) 443
Sse9I AATT 2 cut(s) 187, 455
SspMI CTAG 2 cut(s) 134, 469
StyD4I CCNGG 3 cut(s) 49, 117, 327
TaaI ACNGT 1 cut(s) 322
TaqI TCGA 1 cut(s) 192
TasI AATT 2 cut(s) 187, 455
Tru1I TTAA 3 cut(s) 213, 434, 459
Tru9I TTAA 3 cut(s) 213, 434, 459
Van91I CCANNNNNTGG 3 cut(s) 173, 254, 287
VpaK11BI GGWCC 2 cut(s) 245, 395
XapI RAATTY 1 cut(s) 455
XceI RCATGY 1 cut(s) 443
XmiI GTMKAC 1 cut(s) 361
XspI CTAG 2 cut(s) 134, 469
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.